Mutagenetix > Incidental Mutation

Incidental Mutation 'R4816:Cit'

369787

Institutional Source

Beutler Lab

Gene Symbol

Cit

Ensembl Gene

ENSMUSG00000029516

Gene Name

citron

Synonyms

CRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase

MMRRC Submission

042434-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.949) question?

Stock #

R4816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

115845278-116008947 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 115908691 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 388 (D388N)

Ref Sequence

ENSEMBL: ENSMUSP00000062049 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000051704
AA Change: D388N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: D388N

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	891	905	N/A	INTRINSIC
low complexity region	915	948	N/A	INTRINSIC
low complexity region	950	968	N/A	INTRINSIC
low complexity region	1068	1081	N/A	INTRINSIC
low complexity region	1138	1156	N/A	INTRINSIC
low complexity region	1182	1203	N/A	INTRINSIC
internal_repeat_1	1243	1282	1.05e-5	PROSPERO
low complexity region	1353	1364	N/A	INTRINSIC
C1	1389	1437	1.97e-9	SMART
PH	1470	1591	1.31e-8	SMART
CNH	1618	1915	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102560
AA Change: D388N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: D388N

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1244	N/A	INTRINSIC
coiled coil region	1297	1338	N/A	INTRINSIC
low complexity region	1368	1379	N/A	INTRINSIC
C1	1404	1452	1.97e-9	SMART
PH	1485	1606	1.31e-8	SMART
CNH	1633	1930	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112008
AA Change: D388N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: D388N

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1202	N/A	INTRINSIC
coiled coil region	1255	1296	N/A	INTRINSIC
low complexity region	1326	1337	N/A	INTRINSIC
C1	1362	1410	1.97e-9	SMART
PH	1443	1564	1.31e-8	SMART
CNH	1591	1888	1.78e-112	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128702

Predicted Effect

probably damaging
Transcript: ENSMUST00000141101
AA Change: D388N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: D388N

Domain	Start	End	E-Value	Type
S_TKc	97	359	1.4e-91	SMART
S_TK_X	360	422	3e-18	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	686	698	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	873	906	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1096	1114	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
internal_repeat_1	1201	1240	1.73e-5	PROSPERO
low complexity region	1311	1322	N/A	INTRINSIC
C1	1347	1395	9.7e-12	SMART
PH	1428	1549	6e-11	SMART
CNH	1576	1873	8.6e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146387

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201457

Meta Mutation Damage Score

0.3280

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (113/116)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,615,243	I248S	possibly damaging	Het
8030462N17Rik	A	T	18: 77,653,299		probably null	Het
Abcc8	C	A	7: 46,104,707	A1562S	probably benign	Het
Adam30	C	A	3: 98,162,745	D631E	possibly damaging	Het
Adgrv1	T	C	13: 81,528,674	T2013A	probably damaging	Het
Als2cr12	G	A	1: 58,670,408	A196V	probably benign	Het
Baiap3	T	A	17: 25,247,295		probably benign	Het
Bicra	T	C	7: 15,988,906	T229A	possibly damaging	Het
C1qbp	A	G	11: 70,982,364		probably benign	Het
C2cd3	C	A	7: 100,391,019	T265K	probably benign	Het
Cacna1s	T	A	1: 136,115,269	I1331K	possibly damaging	Het
Cdadc1	AGACGGA	AGA	14: 59,568,991		probably null	Het
Cdcp2	A	G	4: 107,106,772	Y273C	probably damaging	Het
Cdh23	A	C	10: 60,409,077	V1013G	possibly damaging	Het
Celf3	T	A	3: 94,479,222	I39N	probably damaging	Het
Cep152	A	C	2: 125,563,754	S1619R	probably damaging	Het
Cfap36	A	G	11: 29,245,108	I42T	probably damaging	Het
Cfap61	G	T	2: 146,143,100	V955L	probably damaging	Het
Clca3a2	T	C	3: 144,810,852	M328V	probably benign	Het
Cntn4	A	T	6: 106,550,497	I447L	probably benign	Het
Csmd3	T	C	15: 47,857,934	T1538A	possibly damaging	Het
Cstf1	A	G	2: 172,372,985	K9E	probably damaging	Het
Dip2c	T	A	13: 9,575,150	M560K	probably benign	Het
Dsg1a	A	T	18: 20,333,722	T550S	probably benign	Het
Dtnb	A	G	12: 3,749,505	E460G	probably damaging	Het
Dus1l	GAGGTAAG	GAG	11: 120,789,758		probably benign	Het
Efl1	T	A	7: 82,671,719	V120E	probably damaging	Het
Fbxl13	T	C	5: 21,484,003	Y769C	probably benign	Het
Fcho2	T	C	13: 98,806,366	Y22C	probably damaging	Het
Gbp3	T	C	3: 142,567,574	V294A	probably damaging	Het
Gls	A	G	1: 52,199,945		probably benign	Het
Gm15130	A	T	2: 111,135,369		probably benign	Het
Gm6185	A	T	1: 161,213,158		noncoding transcript	Het
Gpr171	T	A	3: 59,098,096	H86L	probably damaging	Het
Gpr179	T	C	11: 97,339,248	T694A	probably damaging	Het
H2-Aa	A	T	17: 34,283,820	V124E	probably damaging	Het
H2-M5	A	G	17: 36,989,417		probably benign	Het
Hist1h2bl	A	G	13: 21,715,965	M60T	probably benign	Het
Igf2r	A	T	17: 12,684,097	N2355K	probably damaging	Het
Il9r	A	C	11: 32,192,654	S295A	possibly damaging	Het
Ipo9	T	C	1: 135,406,550	T313A	probably benign	Het
Kalrn	C	T	16: 34,514,019		probably benign	Het
Lama3	G	A	18: 12,477,604	V1175M	possibly damaging	Het
Lhpp	T	A	7: 132,670,375	C242*	probably null	Het
Lipe	A	G	7: 25,380,143	S1013P	probably damaging	Het
Lrrc25	C	T	8: 70,618,076	T169I	probably benign	Het
Lrrc39	T	C	3: 116,568,866		probably null	Het
Lrrd1	T	A	5: 3,851,126	L477*	probably null	Het
Lrriq4	A	G	3: 30,660,047	I515V	possibly damaging	Het
Magel2	A	G	7: 62,381,092	Y1248C	unknown	Het
Maml1	G	T	11: 50,258,335	N859K	possibly damaging	Het
Mdm1	A	T	10: 118,146,877	H139L	possibly damaging	Het
Mef2d	C	T	3: 88,168,090	P420S	possibly damaging	Het
Mgat4b	A	G	11: 50,211,021	K38E	probably benign	Het
Mtmr4	T	C	11: 87,604,097	V405A	probably damaging	Het
Naip5	G	A	13: 100,219,681	S1142F	probably benign	Het
Naip5	G	A	13: 100,219,687	T1140M	probably benign	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Nfe2l3	T	C	6: 51,456,624	S239P	probably damaging	Het
Nlrp3	A	G	11: 59,548,301	I235V	probably benign	Het
Nyap2	T	A	1: 81,241,313	L318Q	probably damaging	Het
Nynrin	G	A	14: 55,872,001	V1522M	probably damaging	Het
Olfr1016	A	T	2: 85,800,047	N74K	probably benign	Het
Olfr1461	A	G	19: 13,165,124	I37V	probably benign	Het
Olfr659	C	T	7: 104,670,735	P11L	probably benign	Het
Olfr810	T	C	10: 129,791,439	D50G	probably damaging	Het
Olfr875	T	A	9: 37,773,430	M257K	possibly damaging	Het
Oog3	A	G	4: 144,159,161	L289P	probably damaging	Het
Pax6	T	C	2: 105,683,784		probably benign	Het
Pbrm1	G	A	14: 31,110,448	R1441K	probably benign	Het
Pcdha9	C	T	18: 36,999,458	R527W	probably damaging	Het
Pcdhb17	T	C	18: 37,487,397	S747P	probably benign	Het
Pcnx3	A	C	19: 5,687,995		probably null	Het
Pds5a	A	T	5: 65,651,289	V413E	probably damaging	Het
Phpt1	G	T	2: 25,574,320		probably benign	Het
Phykpl	A	G	11: 51,592,953	E220G	probably benign	Het
Pias2	T	C	18: 77,105,891		probably null	Het
Pkhd1	T	A	1: 20,199,415	I3302L	probably damaging	Het
Poli	A	G	18: 70,522,751	L241P	probably damaging	Het
Ppm1h	T	A	10: 122,679,379	I65N	possibly damaging	Het
Ptpn14	T	C	1: 189,856,800	L954P	probably damaging	Het
Pxk	T	G	14: 8,136,893	M138R	probably damaging	Het
Rasl11b	G	T	5: 74,198,397	D188Y	probably damaging	Het
Rtraf	A	G	14: 19,822,576	F59S	probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Setdb2	G	A	14: 59,413,646	T412I	probably benign	Het
Shank2	C	A	7: 144,052,306	N75K	probably damaging	Het
Shank3	T	A	15: 89,543,115	I791N	probably damaging	Het
Slc25a13	T	A	6: 6,114,274	M213L	possibly damaging	Het
Slc25a21	T	C	12: 56,713,838	Y298C	probably damaging	Het
Slc34a2	A	G	5: 53,069,020	N495S	probably damaging	Het
Smc2	A	G	4: 52,451,231	T292A	probably benign	Het
Spag9	T	C	11: 94,048,599		probably benign	Het
Tas2r113	C	T	6: 132,893,782	P258S	probably benign	Het
Tbkbp1	T	C	11: 97,138,741	S530G	probably benign	Het
Tenm2	A	G	11: 36,027,290	V1881A	probably damaging	Het
Tm9sf1	C	T	14: 55,641,149	R262Q	possibly damaging	Het
Tmcc3	G	T	10: 94,578,784	G147V	possibly damaging	Het
Trim38	A	T	13: 23,788,281	E195V	probably damaging	Het
Try5	T	C	6: 41,313,415	Y45C	probably benign	Het
Umad1	A	C	6: 8,457,462		probably benign	Het
Vmn2r105	T	C	17: 20,208,691	I708V	probably benign	Het
Zc3h12d	A	T	10: 7,867,947	S494C	probably damaging	Het
Zeb2	A	G	2: 44,997,768	S382P	probably damaging	Het
Zfc3h1	A	G	10: 115,415,694	S1304G	probably benign	Het
Zfp287	G	T	11: 62,714,248	T611K	probably damaging	Het
Zfp534	G	A	4: 147,674,286	T642I	possibly damaging	Het

Other mutations in Cit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Cit	APN	5	115846465	missense	probably damaging	0.99
IGL00482:Cit	APN	5	115938755	missense	probably damaging	0.97
IGL01317:Cit	APN	5	115908716	missense	probably benign	0.03
IGL01335:Cit	APN	5	115908830	splice site	probably benign
IGL01415:Cit	APN	5	115941903	missense	possibly damaging	0.78
IGL01447:Cit	APN	5	115873843	splice site	probably benign
IGL01537:Cit	APN	5	115933854	missense	probably benign	0.00
IGL01621:Cit	APN	5	115992603	splice site	probably benign
IGL02010:Cit	APN	5	115875947	missense	probably damaging	1.00
IGL02538:Cit	APN	5	115986989	nonsense	probably null
IGL02607:Cit	APN	5	115859209	missense	probably benign
IGL02720:Cit	APN	5	115995452	missense	probably benign	0.26
IGL02725:Cit	APN	5	115985473	missense	probably benign	0.02
IGL02967:Cit	APN	5	115945837	missense	probably benign	0.11
IGL02973:Cit	APN	5	116005999	missense	possibly damaging	0.73
IGL03383:Cit	APN	5	115873845	splice site	probably benign
PIT4514001:Cit	UTSW	5	115997854	critical splice donor site	probably null
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0226:Cit	UTSW	5	115984840	missense	probably damaging	0.99
R0320:Cit	UTSW	5	115979445	missense	possibly damaging	0.87
R0401:Cit	UTSW	5	115985479	missense	probably benign	0.06
R0480:Cit	UTSW	5	115933393	splice site	probably benign
R0609:Cit	UTSW	5	115873943	missense	probably damaging	0.98
R0737:Cit	UTSW	5	115946919	missense	probably damaging	1.00
R1238:Cit	UTSW	5	115851221	missense	probably benign	0.30
R1503:Cit	UTSW	5	115873900	missense	possibly damaging	0.94
R1551:Cit	UTSW	5	115945842	missense	probably benign	0.00
R1602:Cit	UTSW	5	115997730	missense	probably damaging	1.00
R1720:Cit	UTSW	5	115967897	missense	probably damaging	0.98
R1854:Cit	UTSW	5	115873901	missense	probably damaging	1.00
R1886:Cit	UTSW	5	115933486	missense	probably damaging	1.00
R2024:Cit	UTSW	5	115947924	missense	probably damaging	0.97
R2024:Cit	UTSW	5	116005840	missense	probably damaging	0.97
R2048:Cit	UTSW	5	115886813	splice site	probably null
R2128:Cit	UTSW	5	115985507	missense	possibly damaging	0.63
R2192:Cit	UTSW	5	115968009	missense	probably benign	0.00
R2244:Cit	UTSW	5	115926505	missense	probably damaging	1.00
R2518:Cit	UTSW	5	115987046	missense	probably damaging	0.99
R2679:Cit	UTSW	5	115969115	missense	probably benign	0.00
R2898:Cit	UTSW	5	115873978	splice site	probably null
R2908:Cit	UTSW	5	115981676	missense	probably benign	0.00
R3079:Cit	UTSW	5	115925486	missense	probably damaging	0.97
R3779:Cit	UTSW	5	115859341	missense	probably benign	0.01
R4081:Cit	UTSW	5	115948050	missense	probably damaging	1.00
R4494:Cit	UTSW	5	115873984	missense	probably damaging	1.00
R4610:Cit	UTSW	5	115994087	missense	probably benign	0.01
R4757:Cit	UTSW	5	115997549	missense	probably damaging	1.00
R4788:Cit	UTSW	5	115933506	missense	probably damaging	1.00
R4890:Cit	UTSW	5	115988123	intron	probably benign
R4899:Cit	UTSW	5	115863028	missense	possibly damaging	0.60
R4928:Cit	UTSW	5	115985797	missense	probably benign	0.00
R5073:Cit	UTSW	5	115946843	missense	probably benign	0.24
R5151:Cit	UTSW	5	115979835	missense	probably damaging	1.00
R5154:Cit	UTSW	5	115988405	missense	probably damaging	1.00
R5222:Cit	UTSW	5	115952543	missense	probably benign	0.03
R5814:Cit	UTSW	5	115979419	missense	probably damaging	1.00
R5935:Cit	UTSW	5	115925539	intron	probably benign
R5946:Cit	UTSW	5	115997534	missense	probably damaging	1.00
R6051:Cit	UTSW	5	115846405	missense	probably benign
R6289:Cit	UTSW	5	116006326	makesense	probably null
R6298:Cit	UTSW	5	115948065	missense	probably damaging	1.00
R6362:Cit	UTSW	5	115886676	missense	probably benign	0.01
R6545:Cit	UTSW	5	115846434	missense	probably null	0.00
R6761:Cit	UTSW	5	115908675	missense	probably damaging	1.00
R6798:Cit	UTSW	5	115926526	missense	possibly damaging	0.56
R6814:Cit	UTSW	5	115884963	missense	probably damaging	1.00
R6825:Cit	UTSW	5	115981774	missense	probably damaging	0.99
R6845:Cit	UTSW	5	115984888	missense	probably damaging	1.00
R6983:Cit	UTSW	5	115994091	missense	probably damaging	1.00
R7164:Cit	UTSW	5	115985787	missense	possibly damaging	0.94
R7359:Cit	UTSW	5	115926574	missense	probably damaging	1.00
R7597:Cit	UTSW	5	115886681	nonsense	probably null
R7729:Cit	UTSW	5	115984822	missense	possibly damaging	0.87
R7763:Cit	UTSW	5	115987001	missense	probably benign	0.01
R7786:Cit	UTSW	5	115863018	missense	probably benign	0.00
R7799:Cit	UTSW	5	115862968	missense	probably benign	0.00
R8060:Cit	UTSW	5	115908727	missense	probably benign	0.00
R8068:Cit	UTSW	5	115952466	missense	probably damaging	1.00
R8068:Cit	UTSW	5	115982235	missense	probably benign	0.03
R8122:Cit	UTSW	5	115969010	missense	probably damaging	1.00
R8177:Cit	UTSW	5	115988159	missense	probably benign	0.18
R8178:Cit	UTSW	5	115969072	missense	probably damaging	1.00
R8265:Cit	UTSW	5	115988177	missense	probably damaging	1.00
R8359:Cit	UTSW	5	115984544	splice site	probably null
R8397:Cit	UTSW	5	115886797	missense	probably benign
R8489:Cit	UTSW	5	115945903	critical splice donor site	probably null
R8784:Cit	UTSW	5	115846383	nonsense	probably null
R8798:Cit	UTSW	5	115969043	missense	probably damaging	0.99
R8882:Cit	UTSW	5	115863030	missense	probably benign	0.04
R8984:Cit	UTSW	5	115926475	missense	possibly damaging	0.86
R9091:Cit	UTSW	5	115846102	intron	probably benign
R9127:Cit	UTSW	5	115936837	nonsense	probably null
R9204:Cit	UTSW	5	115988439	missense	probably damaging	0.99
R9212:Cit	UTSW	5	115875893	missense	possibly damaging	0.75
R9279:Cit	UTSW	5	115927911	missense	probably damaging	1.00
R9288:Cit	UTSW	5	115985453	missense	probably damaging	1.00
R9377:Cit	UTSW	5	115946855	missense	probably benign	0.04
R9520:Cit	UTSW	5	115941895	nonsense	probably null
Z1088:Cit	UTSW	5	115985533	missense	possibly damaging	0.62
Z1176:Cit	UTSW	5	115986603	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGCTGGGTTGAAAGCAGTC -3'
(R):5'- CCGAGCATCAACAGTCTAGC -3'

Sequencing Primer
(F):5'- AGTCGCTGCAGTGCTGTCTC -3'
(R):5'- AGCATCAGCACCTTTGGC -3'

Posted On

2016-02-04