Incidental Mutation 'R4816:Cit'
ID369787
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Namecitron
SynonymsCRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase
MMRRC Submission 042434-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R4816 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location115845278-116008947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 115908691 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 388 (D388N)
Ref Sequence ENSEMBL: ENSMUSP00000062049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000141101]
Predicted Effect probably damaging
Transcript: ENSMUST00000051704
AA Change: D388N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: D388N

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102560
AA Change: D388N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: D388N

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112008
AA Change: D388N

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: D388N

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128702
Predicted Effect probably damaging
Transcript: ENSMUST00000141101
AA Change: D388N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: D388N

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201457
Meta Mutation Damage Score 0.3280 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 probably null Het
Abcc8 C A 7: 46,104,707 A1562S probably benign Het
Adam30 C A 3: 98,162,745 D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 A196V probably benign Het
Baiap3 T A 17: 25,247,295 probably benign Het
Bicra T C 7: 15,988,906 T229A possibly damaging Het
C1qbp A G 11: 70,982,364 probably benign Het
C2cd3 C A 7: 100,391,019 T265K probably benign Het
Cacna1s T A 1: 136,115,269 I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdcp2 A G 4: 107,106,772 Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 I39N probably damaging Het
Cep152 A C 2: 125,563,754 S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 I42T probably damaging Het
Cfap61 G T 2: 146,143,100 V955L probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Cntn4 A T 6: 106,550,497 I447L probably benign Het
Csmd3 T C 15: 47,857,934 T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 K9E probably damaging Het
Dip2c T A 13: 9,575,150 M560K probably benign Het
Dsg1a A T 18: 20,333,722 T550S probably benign Het
Dtnb A G 12: 3,749,505 E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 probably benign Het
Efl1 T A 7: 82,671,719 V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 Y769C probably benign Het
Fcho2 T C 13: 98,806,366 Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 V294A probably damaging Het
Gls A G 1: 52,199,945 probably benign Het
Gm15130 A T 2: 111,135,369 probably benign Het
Gm6185 A T 1: 161,213,158 noncoding transcript Het
Gpr171 T A 3: 59,098,096 H86L probably damaging Het
Gpr179 T C 11: 97,339,248 T694A probably damaging Het
H2-Aa A T 17: 34,283,820 V124E probably damaging Het
H2-M5 A G 17: 36,989,417 probably benign Het
Hist1h2bl A G 13: 21,715,965 M60T probably benign Het
Igf2r A T 17: 12,684,097 N2355K probably damaging Het
Il9r A C 11: 32,192,654 S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 T313A probably benign Het
Kalrn C T 16: 34,514,019 probably benign Het
Lama3 G A 18: 12,477,604 V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 C242* probably null Het
Lipe A G 7: 25,380,143 S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 T169I probably benign Het
Lrrc39 T C 3: 116,568,866 probably null Het
Lrrd1 T A 5: 3,851,126 L477* probably null Het
Lrriq4 A G 3: 30,660,047 I515V possibly damaging Het
Magel2 A G 7: 62,381,092 Y1248C unknown Het
Maml1 G T 11: 50,258,335 N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 H139L possibly damaging Het
Mef2d C T 3: 88,168,090 P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 K38E probably benign Het
Mtmr4 T C 11: 87,604,097 V405A probably damaging Het
Naip5 G A 13: 100,219,681 S1142F probably benign Het
Naip5 G A 13: 100,219,687 T1140M probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nfe2l3 T C 6: 51,456,624 S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 I235V probably benign Het
Nyap2 T A 1: 81,241,313 L318Q probably damaging Het
Nynrin G A 14: 55,872,001 V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 N74K probably benign Het
Olfr1461 A G 19: 13,165,124 I37V probably benign Het
Olfr659 C T 7: 104,670,735 P11L probably benign Het
Olfr810 T C 10: 129,791,439 D50G probably damaging Het
Olfr875 T A 9: 37,773,430 M257K possibly damaging Het
Oog3 A G 4: 144,159,161 L289P probably damaging Het
Pax6 T C 2: 105,683,784 probably benign Het
Pbrm1 G A 14: 31,110,448 R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 S747P probably benign Het
Pcnx3 A C 19: 5,687,995 probably null Het
Pds5a A T 5: 65,651,289 V413E probably damaging Het
Phpt1 G T 2: 25,574,320 probably benign Het
Phykpl A G 11: 51,592,953 E220G probably benign Het
Pias2 T C 18: 77,105,891 probably null Het
Pkhd1 T A 1: 20,199,415 I3302L probably damaging Het
Poli A G 18: 70,522,751 L241P probably damaging Het
Ppm1h T A 10: 122,679,379 I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 L954P probably damaging Het
Pxk T G 14: 8,136,893 M138R probably damaging Het
Rasl11b G T 5: 74,198,397 D188Y probably damaging Het
Rtraf A G 14: 19,822,576 F59S probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setdb2 G A 14: 59,413,646 T412I probably benign Het
Shank2 C A 7: 144,052,306 N75K probably damaging Het
Shank3 T A 15: 89,543,115 I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 N495S probably damaging Het
Smc2 A G 4: 52,451,231 T292A probably benign Het
Spag9 T C 11: 94,048,599 probably benign Het
Tas2r113 C T 6: 132,893,782 P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 S530G probably benign Het
Tenm2 A G 11: 36,027,290 V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 G147V possibly damaging Het
Trim38 A T 13: 23,788,281 E195V probably damaging Het
Try5 T C 6: 41,313,415 Y45C probably benign Het
Umad1 A C 6: 8,457,462 probably benign Het
Vmn2r105 T C 17: 20,208,691 I708V probably benign Het
Zc3h12d A T 10: 7,867,947 S494C probably damaging Het
Zeb2 A G 2: 44,997,768 S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 S1304G probably benign Het
Zfp287 G T 11: 62,714,248 T611K probably damaging Het
Zfp534 G A 4: 147,674,286 T642I possibly damaging Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115846465 missense probably damaging 0.99
IGL00482:Cit APN 5 115938755 missense probably damaging 0.97
IGL01317:Cit APN 5 115908716 missense probably benign 0.03
IGL01335:Cit APN 5 115908830 splice site probably benign
IGL01415:Cit APN 5 115941903 missense possibly damaging 0.78
IGL01447:Cit APN 5 115873843 splice site probably benign
IGL01537:Cit APN 5 115933854 missense probably benign 0.00
IGL01621:Cit APN 5 115992603 splice site probably benign
IGL02010:Cit APN 5 115875947 missense probably damaging 1.00
IGL02538:Cit APN 5 115986989 nonsense probably null
IGL02607:Cit APN 5 115859209 missense probably benign
IGL02720:Cit APN 5 115995452 missense probably benign 0.26
IGL02725:Cit APN 5 115985473 missense probably benign 0.02
IGL02967:Cit APN 5 115945837 missense probably benign 0.11
IGL02973:Cit APN 5 116005999 missense possibly damaging 0.73
IGL03383:Cit APN 5 115873845 splice site probably benign
PIT4514001:Cit UTSW 5 115997854 critical splice donor site probably null
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0226:Cit UTSW 5 115984840 missense probably damaging 0.99
R0320:Cit UTSW 5 115979445 missense possibly damaging 0.87
R0401:Cit UTSW 5 115985479 missense probably benign 0.06
R0480:Cit UTSW 5 115933393 splice site probably benign
R0609:Cit UTSW 5 115873943 missense probably damaging 0.98
R0737:Cit UTSW 5 115946919 missense probably damaging 1.00
R1238:Cit UTSW 5 115851221 missense probably benign 0.30
R1503:Cit UTSW 5 115873900 missense possibly damaging 0.94
R1551:Cit UTSW 5 115945842 missense probably benign 0.00
R1602:Cit UTSW 5 115997730 missense probably damaging 1.00
R1720:Cit UTSW 5 115967897 missense probably damaging 0.98
R1854:Cit UTSW 5 115873901 missense probably damaging 1.00
R1886:Cit UTSW 5 115933486 missense probably damaging 1.00
R2024:Cit UTSW 5 115947924 missense probably damaging 0.97
R2024:Cit UTSW 5 116005840 missense probably damaging 0.97
R2048:Cit UTSW 5 115886813 splice site probably null
R2128:Cit UTSW 5 115985507 missense possibly damaging 0.63
R2192:Cit UTSW 5 115968009 missense probably benign 0.00
R2244:Cit UTSW 5 115926505 missense probably damaging 1.00
R2518:Cit UTSW 5 115987046 missense probably damaging 0.99
R2679:Cit UTSW 5 115969115 missense probably benign 0.00
R2898:Cit UTSW 5 115873978 splice site probably null
R2908:Cit UTSW 5 115981676 missense probably benign 0.00
R3079:Cit UTSW 5 115925486 missense probably damaging 0.97
R3779:Cit UTSW 5 115859341 missense probably benign 0.01
R4081:Cit UTSW 5 115948050 missense probably damaging 1.00
R4494:Cit UTSW 5 115873984 missense probably damaging 1.00
R4610:Cit UTSW 5 115994087 missense probably benign 0.01
R4757:Cit UTSW 5 115997549 missense probably damaging 1.00
R4788:Cit UTSW 5 115933506 missense probably damaging 1.00
R4890:Cit UTSW 5 115988123 intron probably benign
R4899:Cit UTSW 5 115863028 missense possibly damaging 0.60
R4928:Cit UTSW 5 115985797 missense probably benign 0.00
R5073:Cit UTSW 5 115946843 missense probably benign 0.24
R5151:Cit UTSW 5 115979835 missense probably damaging 1.00
R5154:Cit UTSW 5 115988405 missense probably damaging 1.00
R5222:Cit UTSW 5 115952543 missense probably benign 0.03
R5814:Cit UTSW 5 115979419 missense probably damaging 1.00
R5935:Cit UTSW 5 115925539 intron probably benign
R5946:Cit UTSW 5 115997534 missense probably damaging 1.00
R6051:Cit UTSW 5 115846405 missense probably benign
R6289:Cit UTSW 5 116006326 makesense probably null
R6298:Cit UTSW 5 115948065 missense probably damaging 1.00
R6362:Cit UTSW 5 115886676 missense probably benign 0.01
R6545:Cit UTSW 5 115846434 missense probably null 0.00
R6761:Cit UTSW 5 115908675 missense probably damaging 1.00
R6798:Cit UTSW 5 115926526 missense possibly damaging 0.56
R6814:Cit UTSW 5 115884963 missense probably damaging 1.00
R6825:Cit UTSW 5 115981774 missense probably damaging 0.99
R6845:Cit UTSW 5 115984888 missense probably damaging 1.00
R6983:Cit UTSW 5 115994091 missense probably damaging 1.00
R7164:Cit UTSW 5 115985787 missense possibly damaging 0.94
R7359:Cit UTSW 5 115926574 missense probably damaging 1.00
R7597:Cit UTSW 5 115886681 nonsense probably null
R7729:Cit UTSW 5 115984822 missense possibly damaging 0.87
R7763:Cit UTSW 5 115987001 missense probably benign 0.01
R7786:Cit UTSW 5 115863018 missense probably benign 0.00
R7799:Cit UTSW 5 115862968 missense probably benign 0.00
R8060:Cit UTSW 5 115908727 missense probably benign 0.00
R8068:Cit UTSW 5 115952466 missense probably damaging 1.00
R8068:Cit UTSW 5 115982235 missense probably benign 0.03
R8122:Cit UTSW 5 115969010 missense probably damaging 1.00
R8177:Cit UTSW 5 115988159 missense probably benign 0.18
R8178:Cit UTSW 5 115969072 missense probably damaging 1.00
R8265:Cit UTSW 5 115988177 missense probably damaging 1.00
R8397:Cit UTSW 5 115886797 missense probably benign
Z1088:Cit UTSW 5 115985533 missense possibly damaging 0.62
Z1176:Cit UTSW 5 115986603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCTGGGTTGAAAGCAGTC -3'
(R):5'- CCGAGCATCAACAGTCTAGC -3'

Sequencing Primer
(F):5'- AGTCGCTGCAGTGCTGTCTC -3'
(R):5'- AGCATCAGCACCTTTGGC -3'
Posted On2016-02-04