Incidental Mutation 'R4816:Umad1'
ID 369790
Institutional Source Beutler Lab
Gene Symbol Umad1
Ensembl Gene ENSMUSG00000089862
Gene Name UMAP1-MVP12 associated (UMA) domain containing 1
Synonyms Gm16039
MMRRC Submission 042434-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R4816 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 8259288-8428767 bp(+) (GRCm39)
Type of Mutation intron
DNA Base Change (assembly) A to C at 8457462 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159335] [ENSMUST00000162564]
AlphaFold E0CX23
Predicted Effect unknown
Transcript: ENSMUST00000159335
AA Change: H125P
Predicted Effect probably benign
Transcript: ENSMUST00000162564
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C A 7: 45,754,131 (GRCm39) A1562S probably benign Het
Adam30 C A 3: 98,070,061 (GRCm39) D631E possibly damaging Het
Adgrv1 T C 13: 81,676,793 (GRCm39) T2013A probably damaging Het
Ark2n A T 18: 77,740,995 (GRCm39) probably null Het
Baiap3 T A 17: 25,466,269 (GRCm39) probably benign Het
Bicra T C 7: 15,722,831 (GRCm39) T229A possibly damaging Het
C1qbp A G 11: 70,873,190 (GRCm39) probably benign Het
C2cd3 C A 7: 100,040,226 (GRCm39) T265K probably benign Het
Cacna1s T A 1: 136,043,007 (GRCm39) I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,806,440 (GRCm39) probably null Het
Cdcp2 A G 4: 106,963,969 (GRCm39) Y273C probably damaging Het
Cdh23 A C 10: 60,244,856 (GRCm39) V1013G possibly damaging Het
Celf3 T A 3: 94,386,529 (GRCm39) I39N probably damaging Het
Cep152 A C 2: 125,405,674 (GRCm39) S1619R probably damaging Het
Cfap36 A G 11: 29,195,108 (GRCm39) I42T probably damaging Het
Cfap61 G T 2: 145,985,020 (GRCm39) V955L probably damaging Het
Cit G A 5: 116,046,750 (GRCm39) D388N probably damaging Het
Clca3a2 T C 3: 144,516,613 (GRCm39) M328V probably benign Het
Cntn4 A T 6: 106,527,458 (GRCm39) I447L probably benign Het
Csmd3 T C 15: 47,721,330 (GRCm39) T1538A possibly damaging Het
Cstf1 A G 2: 172,214,905 (GRCm39) K9E probably damaging Het
Dip2c T A 13: 9,625,186 (GRCm39) M560K probably benign Het
Dsg1a A T 18: 20,466,779 (GRCm39) T550S probably benign Het
Dtnb A G 12: 3,799,505 (GRCm39) E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,680,584 (GRCm39) probably benign Het
Efl1 T A 7: 82,320,927 (GRCm39) V120E probably damaging Het
Fbxl13 T C 5: 21,689,001 (GRCm39) Y769C probably benign Het
Fcho2 T C 13: 98,942,874 (GRCm39) Y22C probably damaging Het
Flacc1 G A 1: 58,709,567 (GRCm39) A196V probably benign Het
Gbp3 T C 3: 142,273,335 (GRCm39) V294A probably damaging Het
Gls A G 1: 52,239,104 (GRCm39) probably benign Het
Gm15130 A T 2: 110,965,714 (GRCm39) probably benign Het
Gm6185 A T 1: 161,040,728 (GRCm39) noncoding transcript Het
Gpr171 T A 3: 59,005,517 (GRCm39) H86L probably damaging Het
Gpr179 T C 11: 97,230,074 (GRCm39) T694A probably damaging Het
H2-Aa A T 17: 34,502,794 (GRCm39) V124E probably damaging Het
H2bc13 A G 13: 21,900,135 (GRCm39) M60T probably benign Het
H2-M5 A G 17: 37,300,309 (GRCm39) probably benign Het
Igf2r A T 17: 12,902,984 (GRCm39) N2355K probably damaging Het
Il9r A C 11: 32,142,654 (GRCm39) S295A possibly damaging Het
Ipo9 T C 1: 135,334,288 (GRCm39) T313A probably benign Het
Kalrn C T 16: 34,334,389 (GRCm39) probably benign Het
Lama3 G A 18: 12,610,661 (GRCm39) V1175M possibly damaging Het
Lhpp T A 7: 132,272,104 (GRCm39) C242* probably null Het
Lipe A G 7: 25,079,568 (GRCm39) S1013P probably damaging Het
Lrrc25 C T 8: 71,070,726 (GRCm39) T169I probably benign Het
Lrrc39 T C 3: 116,362,515 (GRCm39) probably null Het
Lrrd1 T A 5: 3,901,126 (GRCm39) L477* probably null Het
Lrriq4 A G 3: 30,714,196 (GRCm39) I515V possibly damaging Het
Magel2 A G 7: 62,030,840 (GRCm39) Y1248C unknown Het
Maml1 G T 11: 50,149,162 (GRCm39) N859K possibly damaging Het
Mdm1 A T 10: 117,982,782 (GRCm39) H139L possibly damaging Het
Mef2d C T 3: 88,075,397 (GRCm39) P420S possibly damaging Het
Mgat4b A G 11: 50,101,848 (GRCm39) K38E probably benign Het
Mtmr4 T C 11: 87,494,923 (GRCm39) V405A probably damaging Het
Naip5 G A 13: 100,356,195 (GRCm39) T1140M probably benign Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G A 13: 100,356,189 (GRCm39) S1142F probably benign Het
Nfe2l3 T C 6: 51,433,604 (GRCm39) S239P probably damaging Het
Nlrp3 A G 11: 59,439,127 (GRCm39) I235V probably benign Het
Nyap2 T A 1: 81,219,028 (GRCm39) L318Q probably damaging Het
Nynrin G A 14: 56,109,458 (GRCm39) V1522M probably damaging Het
Oog3 A G 4: 143,885,731 (GRCm39) L289P probably damaging Het
Or52n20 C T 7: 104,319,942 (GRCm39) P11L probably benign Het
Or5b107 A G 19: 13,142,488 (GRCm39) I37V probably benign Het
Or6c69b T C 10: 129,627,308 (GRCm39) D50G probably damaging Het
Or8b12b T A 9: 37,684,726 (GRCm39) M257K possibly damaging Het
Or9g20 A T 2: 85,630,391 (GRCm39) N74K probably benign Het
Pax6 T C 2: 105,514,129 (GRCm39) probably benign Het
Pbrm1 G A 14: 30,832,405 (GRCm39) R1441K probably benign Het
Pcdha9 C T 18: 37,132,511 (GRCm39) R527W probably damaging Het
Pcdhb17 T C 18: 37,620,450 (GRCm39) S747P probably benign Het
Pcnx3 A C 19: 5,738,023 (GRCm39) probably null Het
Pds5a A T 5: 65,808,632 (GRCm39) V413E probably damaging Het
Phpt1 G T 2: 25,464,332 (GRCm39) probably benign Het
Phykpl A G 11: 51,483,780 (GRCm39) E220G probably benign Het
Pias2 T C 18: 77,193,587 (GRCm39) probably null Het
Pkhd1 T A 1: 20,269,639 (GRCm39) I3302L probably damaging Het
Poli A G 18: 70,655,822 (GRCm39) L241P probably damaging Het
Ppm1h T A 10: 122,515,284 (GRCm39) I65N possibly damaging Het
Ptpn14 T C 1: 189,588,997 (GRCm39) L954P probably damaging Het
Pxk T G 14: 8,136,893 (GRCm38) M138R probably damaging Het
Rasl11b G T 5: 74,359,058 (GRCm39) D188Y probably damaging Het
Rtraf A G 14: 19,872,644 (GRCm39) F59S probably benign Het
Sanbr A C 11: 23,565,243 (GRCm39) I248S possibly damaging Het
Serpinb5 G T 1: 106,800,069 (GRCm39) L86F probably damaging Het
Setdb2 G A 14: 59,651,095 (GRCm39) T412I probably benign Het
Shank2 C A 7: 143,606,043 (GRCm39) N75K probably damaging Het
Shank3 T A 15: 89,427,318 (GRCm39) I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 (GRCm39) M213L possibly damaging Het
Slc25a21 T C 12: 56,760,623 (GRCm39) Y298C probably damaging Het
Slc34a2 A G 5: 53,226,362 (GRCm39) N495S probably damaging Het
Smc2 A G 4: 52,451,231 (GRCm39) T292A probably benign Het
Spag9 T C 11: 93,939,425 (GRCm39) probably benign Het
Tas2r113 C T 6: 132,870,745 (GRCm39) P258S probably benign Het
Tbkbp1 T C 11: 97,029,567 (GRCm39) S530G probably benign Het
Tenm2 A G 11: 35,918,117 (GRCm39) V1881A probably damaging Het
Tm9sf1 C T 14: 55,878,606 (GRCm39) R262Q possibly damaging Het
Tmcc3 G T 10: 94,414,646 (GRCm39) G147V possibly damaging Het
Trim38 A T 13: 23,972,264 (GRCm39) E195V probably damaging Het
Try5 T C 6: 41,290,349 (GRCm39) Y45C probably benign Het
Vmn2r105 T C 17: 20,428,953 (GRCm39) I708V probably benign Het
Zc3h12d A T 10: 7,743,711 (GRCm39) S494C probably damaging Het
Zeb2 A G 2: 44,887,780 (GRCm39) S382P probably damaging Het
Zfc3h1 A G 10: 115,251,599 (GRCm39) S1304G probably benign Het
Zfp287 G T 11: 62,605,074 (GRCm39) T611K probably damaging Het
Zfp534 G A 4: 147,758,743 (GRCm39) T642I possibly damaging Het
Other mutations in Umad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1878:Umad1 UTSW 6 8,427,181 (GRCm39) missense probably damaging 1.00
R2403:Umad1 UTSW 6 8,427,161 (GRCm39) missense possibly damaging 0.84
R2439:Umad1 UTSW 6 8,427,078 (GRCm39) missense probably damaging 1.00
R4774:Umad1 UTSW 6 8,427,181 (GRCm39) missense probably damaging 1.00
R5068:Umad1 UTSW 6 8,401,157 (GRCm39) splice site probably null
R7130:Umad1 UTSW 6 8,427,185 (GRCm39) missense probably null 0.01
R7487:Umad1 UTSW 6 8,270,560 (GRCm39) missense probably damaging 1.00
R7654:Umad1 UTSW 6 8,426,995 (GRCm39) missense probably damaging 0.99
R7843:Umad1 UTSW 6 8,401,140 (GRCm39) missense unknown
R8103:Umad1 UTSW 6 8,427,121 (GRCm39) missense probably damaging 0.97
R9011:Umad1 UTSW 6 8,373,931 (GRCm39) nonsense probably null
R9432:Umad1 UTSW 6 8,401,096 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGGCTCTGGATAGTTGCAGT -3'
(R):5'- TGCAAACACCAGAATGAGCAT -3'

Sequencing Primer
(F):5'- TTGCAGTAACTGGGAAGAGGAGC -3'
(R):5'- GCTGTATTACTAGAAAAAGCCCG -3'
Posted On 2016-02-04