Mutagenetix > Incidental Mutations

Incidental Mutation 'R4816:Shank2'

369804

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

042434-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144001928-144424494 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 144052306 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 75 (N75K)

Ref Sequence

ENSEMBL: ENSMUSP00000101522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105902] [ENSMUST00000213146]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000105902
AA Change: N75K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: N75K

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000213146
AA Change: N75K

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)

Meta Mutation Damage Score

0.3085

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (113/116)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,615,243	I248S	possibly damaging	Het
8030462N17Rik	A	T	18: 77,653,299		probably null	Het
Abcc8	C	A	7: 46,104,707	A1562S	probably benign	Het
Adam30	C	A	3: 98,162,745	D631E	possibly damaging	Het
Adgrv1	T	C	13: 81,528,674	T2013A	probably damaging	Het
Als2cr12	G	A	1: 58,670,408	A196V	probably benign	Het
Baiap3	T	A	17: 25,247,295		probably benign	Het
Bicra	T	C	7: 15,988,906	T229A	possibly damaging	Het
C1qbp	A	G	11: 70,982,364		probably benign	Het
C2cd3	C	A	7: 100,391,019	T265K	probably benign	Het
Cacna1s	T	A	1: 136,115,269	I1331K	possibly damaging	Het
Cdadc1	AGACGGA	AGA	14: 59,568,991		probably null	Het
Cdcp2	A	G	4: 107,106,772	Y273C	probably damaging	Het
Cdh23	A	C	10: 60,409,077	V1013G	possibly damaging	Het
Celf3	T	A	3: 94,479,222	I39N	probably damaging	Het
Cep152	A	C	2: 125,563,754	S1619R	probably damaging	Het
Cfap36	A	G	11: 29,245,108	I42T	probably damaging	Het
Cfap61	G	T	2: 146,143,100	V955L	probably damaging	Het
Cit	G	A	5: 115,908,691	D388N	probably damaging	Het
Clca3a2	T	C	3: 144,810,852	M328V	probably benign	Het
Cntn4	A	T	6: 106,550,497	I447L	probably benign	Het
Csmd3	T	C	15: 47,857,934	T1538A	possibly damaging	Het
Cstf1	A	G	2: 172,372,985	K9E	probably damaging	Het
Dip2c	T	A	13: 9,575,150	M560K	probably benign	Het
Dsg1a	A	T	18: 20,333,722	T550S	probably benign	Het
Dtnb	A	G	12: 3,749,505	E460G	probably damaging	Het
Dus1l	GAGGTAAG	GAG	11: 120,789,758		probably benign	Het
Efl1	T	A	7: 82,671,719	V120E	probably damaging	Het
Fbxl13	T	C	5: 21,484,003	Y769C	probably benign	Het
Fcho2	T	C	13: 98,806,366	Y22C	probably damaging	Het
Gbp3	T	C	3: 142,567,574	V294A	probably damaging	Het
Gls	A	G	1: 52,199,945		probably benign	Het
Gm15130	A	T	2: 111,135,369		probably benign	Het
Gm6185	A	T	1: 161,213,158		noncoding transcript	Het
Gpr171	T	A	3: 59,098,096	H86L	probably damaging	Het
Gpr179	T	C	11: 97,339,248	T694A	probably damaging	Het
H2-Aa	A	T	17: 34,283,820	V124E	probably damaging	Het
H2-M5	A	G	17: 36,989,417		probably benign	Het
Hist1h2bl	A	G	13: 21,715,965	M60T	probably benign	Het
Igf2r	A	T	17: 12,684,097	N2355K	probably damaging	Het
Il9r	A	C	11: 32,192,654	S295A	possibly damaging	Het
Ipo9	T	C	1: 135,406,550	T313A	probably benign	Het
Kalrn	C	T	16: 34,514,019		probably benign	Het
Lama3	G	A	18: 12,477,604	V1175M	possibly damaging	Het
Lhpp	T	A	7: 132,670,375	C242*	probably null	Het
Lipe	A	G	7: 25,380,143	S1013P	probably damaging	Het
Lrrc25	C	T	8: 70,618,076	T169I	probably benign	Het
Lrrc39	T	C	3: 116,568,866		probably null	Het
Lrrd1	T	A	5: 3,851,126	L477*	probably null	Het
Lrriq4	A	G	3: 30,660,047	I515V	possibly damaging	Het
Magel2	A	G	7: 62,381,092	Y1248C	unknown	Het
Maml1	G	T	11: 50,258,335	N859K	possibly damaging	Het
Mdm1	A	T	10: 118,146,877	H139L	possibly damaging	Het
Mef2d	C	T	3: 88,168,090	P420S	possibly damaging	Het
Mgat4b	A	G	11: 50,211,021	K38E	probably benign	Het
Mtmr4	T	C	11: 87,604,097	V405A	probably damaging	Het
Naip5	G	A	13: 100,219,681	S1142F	probably benign	Het
Naip5	G	A	13: 100,219,687	T1140M	probably benign	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Nfe2l3	T	C	6: 51,456,624	S239P	probably damaging	Het
Nlrp3	A	G	11: 59,548,301	I235V	probably benign	Het
Nyap2	T	A	1: 81,241,313	L318Q	probably damaging	Het
Nynrin	G	A	14: 55,872,001	V1522M	probably damaging	Het
Olfr1016	A	T	2: 85,800,047	N74K	probably benign	Het
Olfr1461	A	G	19: 13,165,124	I37V	probably benign	Het
Olfr659	C	T	7: 104,670,735	P11L	probably benign	Het
Olfr810	T	C	10: 129,791,439	D50G	probably damaging	Het
Olfr875	T	A	9: 37,773,430	M257K	possibly damaging	Het
Oog3	A	G	4: 144,159,161	L289P	probably damaging	Het
Pax6	T	C	2: 105,683,784		probably benign	Het
Pbrm1	G	A	14: 31,110,448	R1441K	probably benign	Het
Pcdha9	C	T	18: 36,999,458	R527W	probably damaging	Het
Pcdhb17	T	C	18: 37,487,397	S747P	probably benign	Het
Pcnx3	A	C	19: 5,687,995		probably null	Het
Pds5a	A	T	5: 65,651,289	V413E	probably damaging	Het
Phpt1	G	T	2: 25,574,320		probably benign	Het
Phykpl	A	G	11: 51,592,953	E220G	probably benign	Het
Pias2	T	C	18: 77,105,891		probably null	Het
Pkhd1	T	A	1: 20,199,415	I3302L	probably damaging	Het
Poli	A	G	18: 70,522,751	L241P	probably damaging	Het
Ppm1h	T	A	10: 122,679,379	I65N	possibly damaging	Het
Ptpn14	T	C	1: 189,856,800	L954P	probably damaging	Het
Pxk	T	G	14: 8,136,893	M138R	probably damaging	Het
Rasl11b	G	T	5: 74,198,397	D188Y	probably damaging	Het
Rtraf	A	G	14: 19,822,576	F59S	probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Setdb2	G	A	14: 59,413,646	T412I	probably benign	Het
Shank3	T	A	15: 89,543,115	I791N	probably damaging	Het
Slc25a13	T	A	6: 6,114,274	M213L	possibly damaging	Het
Slc25a21	T	C	12: 56,713,838	Y298C	probably damaging	Het
Slc34a2	A	G	5: 53,069,020	N495S	probably damaging	Het
Smc2	A	G	4: 52,451,231	T292A	probably benign	Het
Spag9	T	C	11: 94,048,599		probably benign	Het
Tas2r113	C	T	6: 132,893,782	P258S	probably benign	Het
Tbkbp1	T	C	11: 97,138,741	S530G	probably benign	Het
Tenm2	A	G	11: 36,027,290	V1881A	probably damaging	Het
Tm9sf1	C	T	14: 55,641,149	R262Q	possibly damaging	Het
Tmcc3	G	T	10: 94,578,784	G147V	possibly damaging	Het
Trim38	A	T	13: 23,788,281	E195V	probably damaging	Het
Try5	T	C	6: 41,313,415	Y45C	probably benign	Het
Umad1	A	C	6: 8,457,462		probably benign	Het
Vmn2r105	T	C	17: 20,208,691	I708V	probably benign	Het
Zc3h12d	A	T	10: 7,867,947	S494C	probably damaging	Het
Zeb2	A	G	2: 44,997,768	S382P	probably damaging	Het
Zfc3h1	A	G	10: 115,415,694	S1304G	probably benign	Het
Zfp287	G	T	11: 62,714,248	T611K	probably damaging	Het
Zfp534	G	A	4: 147,674,286	T642I	possibly damaging	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	144411847	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	144410775	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	144411271	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	144285068	nonsense	probably null
IGL01996:Shank2	APN	7	144411493	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	144285047	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	144411271	missense	probably benign	0.01
IGL02320:Shank2	APN	7	144420944	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	144409636	missense	probably benign	0.03
IGL02997:Shank2	APN	7	144081873	missense	probably benign	0.16
R0077:Shank2	UTSW	7	144192467	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	144410577	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	144031355	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	144070135	missense	probably benign	0.04
R0644:Shank2	UTSW	7	144411849	missense	probably benign
R1072:Shank2	UTSW	7	144411568	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	144411720	missense	probably benign	0.00
R1424:Shank2	UTSW	7	144052372	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	144411153	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	144179853	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	144410599	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	144186858	nonsense	probably null
R2074:Shank2	UTSW	7	144409540	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	144411234	missense	probably damaging	0.99
R2355:Shank2	UTSW	7	144057718	missense	possibly damaging	0.94
R2511:Shank2	UTSW	7	144411577	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	144052305	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	144068770	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	144070055	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	144081874	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	144405384	missense	probably benign
R3907:Shank2	UTSW	7	144409576	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	144128375	missense	probably benign	0.20
R4151:Shank2	UTSW	7	144054828	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	144179781	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	144410862	missense	probably benign	0.09
R4519:Shank2	UTSW	7	144410205	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	144411424	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	144410422	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	144411829	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	144420605	missense	probably benign	0.07
R4751:Shank2	UTSW	7	144409468	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R4929:Shank2	UTSW	7	144411271	missense	probably benign	0.01
R5009:Shank2	UTSW	7	144070179	missense	probably benign	0.00
R5027:Shank2	UTSW	7	144259105	nonsense	probably null
R5165:Shank2	UTSW	7	144409636	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	144068875	critical splice donor site	probably null
R5332:Shank2	UTSW	7	144411292	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	144070109	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	144410134	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	144407223	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	144180031	missense	probably benign	0.12
R6306:Shank2	UTSW	7	144409680	missense	probably benign	0.00
R6317:Shank2	UTSW	7	144285084	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	144031297	missense	probably benign	0.25
R6364:Shank2	UTSW	7	144410409	missense	probably benign	0.14
R6413:Shank2	UTSW	7	144410218	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	144420866	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	144409894	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	144052460	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	144091778	missense	probably benign	0.19
R6983:Shank2	UTSW	7	144081848	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	144410359	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	144411164	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	144411552	missense	probably benign	0.00
R7213:Shank2	UTSW	7	144031409	missense	probably benign	0.17
R7225:Shank2	UTSW	7	144285025	missense	probably benign	0.42
R7325:Shank2	UTSW	7	144411685	missense	probably benign	0.04
R7605:Shank2	UTSW	7	144091779	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	144411394	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	144411061	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	144409875	missense	probably benign	0.01
R8722:Shank2	UTSW	7	144175748	intron	probably benign
R8866:Shank2	UTSW	7	144411249	missense	probably benign
R8919:Shank2	UTSW	7	144411528	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	144070190	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	144411499	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	144068798	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	144409968	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	144407208	missense	probably benign	0.00
R9362:Shank2	UTSW	7	144409534	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	144411015	missense	possibly damaging	0.77
RF009:Shank2	UTSW	7	144411571	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	144128377	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTTGTTTGAGAGACAGAGGCAAAC -3'
(R):5'- AGTTACCTCCAAGGAAGGCAC -3'

Sequencing Primer
(F):5'- GAGACAGAGGCAAACTTTACTTTG -3'
(R):5'- CAAGGAAGGCACACCCGG -3'

Posted On

2016-02-04