Mutagenetix > Incidental Mutations

Incidental Mutation 'R4816:Olfr810'

369815

Institutional Source

Beutler Lab

Gene Symbol

Olfr810

Ensembl Gene

ENSMUSG00000069421

Gene Name

olfactory receptor 810

Synonyms

MOR113-4, GA_x6K02T2PULF-11470271-11469333

MMRRC Submission

042434-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R4816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

129787289-129794917 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 129791439 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 50 (D50G)

Ref Sequence

ENSEMBL: ENSMUSP00000150364 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091986] [ENSMUST00000214206] [ENSMUST00000214878] [ENSMUST00000217283]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091986
AA Change: D50G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089612
Gene: ENSMUSG00000069421
AA Change: D50G

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	306	7.3e-50	PFAM
Pfam:7tm_1	39	288	5e-24	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000214206
AA Change: D50G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000214878
AA Change: D50G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217283
AA Change: D50G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (113/116)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,615,243	I248S	possibly damaging	Het
8030462N17Rik	A	T	18: 77,653,299		probably null	Het
Abcc8	C	A	7: 46,104,707	A1562S	probably benign	Het
Adam30	C	A	3: 98,162,745	D631E	possibly damaging	Het
Adgrv1	T	C	13: 81,528,674	T2013A	probably damaging	Het
Als2cr12	G	A	1: 58,670,408	A196V	probably benign	Het
Baiap3	T	A	17: 25,247,295		probably benign	Het
Bicra	T	C	7: 15,988,906	T229A	possibly damaging	Het
C1qbp	A	G	11: 70,982,364		probably benign	Het
C2cd3	C	A	7: 100,391,019	T265K	probably benign	Het
Cacna1s	T	A	1: 136,115,269	I1331K	possibly damaging	Het
Cdadc1	AGACGGA	AGA	14: 59,568,991		probably null	Het
Cdcp2	A	G	4: 107,106,772	Y273C	probably damaging	Het
Cdh23	A	C	10: 60,409,077	V1013G	possibly damaging	Het
Celf3	T	A	3: 94,479,222	I39N	probably damaging	Het
Cep152	A	C	2: 125,563,754	S1619R	probably damaging	Het
Cfap36	A	G	11: 29,245,108	I42T	probably damaging	Het
Cfap61	G	T	2: 146,143,100	V955L	probably damaging	Het
Cit	G	A	5: 115,908,691	D388N	probably damaging	Het
Clca3a2	T	C	3: 144,810,852	M328V	probably benign	Het
Cntn4	A	T	6: 106,550,497	I447L	probably benign	Het
Csmd3	T	C	15: 47,857,934	T1538A	possibly damaging	Het
Cstf1	A	G	2: 172,372,985	K9E	probably damaging	Het
Dip2c	T	A	13: 9,575,150	M560K	probably benign	Het
Dsg1a	A	T	18: 20,333,722	T550S	probably benign	Het
Dtnb	A	G	12: 3,749,505	E460G	probably damaging	Het
Dus1l	GAGGTAAG	GAG	11: 120,789,758		probably benign	Het
Efl1	T	A	7: 82,671,719	V120E	probably damaging	Het
Fbxl13	T	C	5: 21,484,003	Y769C	probably benign	Het
Fcho2	T	C	13: 98,806,366	Y22C	probably damaging	Het
Gbp3	T	C	3: 142,567,574	V294A	probably damaging	Het
Gls	A	G	1: 52,199,945		probably benign	Het
Gm15130	A	T	2: 111,135,369		probably benign	Het
Gm6185	A	T	1: 161,213,158		noncoding transcript	Het
Gpr171	T	A	3: 59,098,096	H86L	probably damaging	Het
Gpr179	T	C	11: 97,339,248	T694A	probably damaging	Het
H2-Aa	A	T	17: 34,283,820	V124E	probably damaging	Het
H2-M5	A	G	17: 36,989,417		probably benign	Het
Hist1h2bl	A	G	13: 21,715,965	M60T	probably benign	Het
Igf2r	A	T	17: 12,684,097	N2355K	probably damaging	Het
Il9r	A	C	11: 32,192,654	S295A	possibly damaging	Het
Ipo9	T	C	1: 135,406,550	T313A	probably benign	Het
Kalrn	C	T	16: 34,514,019		probably benign	Het
Lama3	G	A	18: 12,477,604	V1175M	possibly damaging	Het
Lhpp	T	A	7: 132,670,375	C242*	probably null	Het
Lipe	A	G	7: 25,380,143	S1013P	probably damaging	Het
Lrrc25	C	T	8: 70,618,076	T169I	probably benign	Het
Lrrc39	T	C	3: 116,568,866		probably null	Het
Lrrd1	T	A	5: 3,851,126	L477*	probably null	Het
Lrriq4	A	G	3: 30,660,047	I515V	possibly damaging	Het
Magel2	A	G	7: 62,381,092	Y1248C	unknown	Het
Maml1	G	T	11: 50,258,335	N859K	possibly damaging	Het
Mdm1	A	T	10: 118,146,877	H139L	possibly damaging	Het
Mef2d	C	T	3: 88,168,090	P420S	possibly damaging	Het
Mgat4b	A	G	11: 50,211,021	K38E	probably benign	Het
Mtmr4	T	C	11: 87,604,097	V405A	probably damaging	Het
Naip5	G	A	13: 100,219,681	S1142F	probably benign	Het
Naip5	G	A	13: 100,219,687	T1140M	probably benign	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Nfe2l3	T	C	6: 51,456,624	S239P	probably damaging	Het
Nlrp3	A	G	11: 59,548,301	I235V	probably benign	Het
Nyap2	T	A	1: 81,241,313	L318Q	probably damaging	Het
Nynrin	G	A	14: 55,872,001	V1522M	probably damaging	Het
Olfr1016	A	T	2: 85,800,047	N74K	probably benign	Het
Olfr1461	A	G	19: 13,165,124	I37V	probably benign	Het
Olfr659	C	T	7: 104,670,735	P11L	probably benign	Het
Olfr875	T	A	9: 37,773,430	M257K	possibly damaging	Het
Oog3	A	G	4: 144,159,161	L289P	probably damaging	Het
Pax6	T	C	2: 105,683,784		probably benign	Het
Pbrm1	G	A	14: 31,110,448	R1441K	probably benign	Het
Pcdha9	C	T	18: 36,999,458	R527W	probably damaging	Het
Pcdhb17	T	C	18: 37,487,397	S747P	probably benign	Het
Pcnx3	A	C	19: 5,687,995		probably null	Het
Pds5a	A	T	5: 65,651,289	V413E	probably damaging	Het
Phpt1	G	T	2: 25,574,320		probably benign	Het
Phykpl	A	G	11: 51,592,953	E220G	probably benign	Het
Pias2	T	C	18: 77,105,891		probably null	Het
Pkhd1	T	A	1: 20,199,415	I3302L	probably damaging	Het
Poli	A	G	18: 70,522,751	L241P	probably damaging	Het
Ppm1h	T	A	10: 122,679,379	I65N	possibly damaging	Het
Ptpn14	T	C	1: 189,856,800	L954P	probably damaging	Het
Pxk	T	G	14: 8,136,893	M138R	probably damaging	Het
Rasl11b	G	T	5: 74,198,397	D188Y	probably damaging	Het
Rtraf	A	G	14: 19,822,576	F59S	probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Setdb2	G	A	14: 59,413,646	T412I	probably benign	Het
Shank2	C	A	7: 144,052,306	N75K	probably damaging	Het
Shank3	T	A	15: 89,543,115	I791N	probably damaging	Het
Slc25a13	T	A	6: 6,114,274	M213L	possibly damaging	Het
Slc25a21	T	C	12: 56,713,838	Y298C	probably damaging	Het
Slc34a2	A	G	5: 53,069,020	N495S	probably damaging	Het
Smc2	A	G	4: 52,451,231	T292A	probably benign	Het
Spag9	T	C	11: 94,048,599		probably benign	Het
Tas2r113	C	T	6: 132,893,782	P258S	probably benign	Het
Tbkbp1	T	C	11: 97,138,741	S530G	probably benign	Het
Tenm2	A	G	11: 36,027,290	V1881A	probably damaging	Het
Tm9sf1	C	T	14: 55,641,149	R262Q	possibly damaging	Het
Tmcc3	G	T	10: 94,578,784	G147V	possibly damaging	Het
Trim38	A	T	13: 23,788,281	E195V	probably damaging	Het
Try5	T	C	6: 41,313,415	Y45C	probably benign	Het
Umad1	A	C	6: 8,457,462		probably benign	Het
Vmn2r105	T	C	17: 20,208,691	I708V	probably benign	Het
Zc3h12d	A	T	10: 7,867,947	S494C	probably damaging	Het
Zeb2	A	G	2: 44,997,768	S382P	probably damaging	Het
Zfc3h1	A	G	10: 115,415,694	S1304G	probably benign	Het
Zfp287	G	T	11: 62,714,248	T611K	probably damaging	Het
Zfp534	G	A	4: 147,674,286	T642I	possibly damaging	Het

Other mutations in Olfr810

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Olfr810	APN	10	129791319	missense	probably damaging	0.98
IGL02365:Olfr810	APN	10	129791535	missense	possibly damaging	0.81
IGL02508:Olfr810	APN	10	129790791	missense	probably benign	0.44
R0638:Olfr810	UTSW	10	129791232	missense	probably damaging	1.00
R0680:Olfr810	UTSW	10	129790818	missense	probably damaging	1.00
R0847:Olfr810	UTSW	10	129791458	missense	probably damaging	1.00
R1449:Olfr810	UTSW	10	129790854	missense	probably damaging	1.00
R1776:Olfr810	UTSW	10	129791131	missense	probably benign	0.00
R1938:Olfr810	UTSW	10	129790890	missense	probably damaging	1.00
R3836:Olfr810	UTSW	10	129791170	missense	probably benign	0.01
R4521:Olfr810	UTSW	10	129791181	missense	possibly damaging	0.58
R6287:Olfr810	UTSW	10	129791385	missense	probably damaging	1.00
R8080:Olfr810	UTSW	10	129791128	missense	probably benign	0.07
R8202:Olfr810	UTSW	10	129790649	makesense	probably null
R8696:Olfr810	UTSW	10	129790693	missense	not run

Predicted Primers

PCR Primer
(F):5'- GCTTGCAGATGGCTACATATCTG -3'
(R):5'- TGCGAACAGTCAGAGGTTCAC -3'

Sequencing Primer
(F):5'- GCAGATGGCTACATATCTGTCATAGG -3'
(R):5'- TCAGAGGTTCACAATGAAGAACC -3'

Posted On

2016-02-04