Incidental Mutation 'R4816:Il9r'
ID369818
Institutional Source Beutler Lab
Gene Symbol Il9r
Ensembl Gene ENSMUSG00000020279
Gene Nameinterleukin 9 receptor
Synonyms
MMRRC Submission 042434-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4816 (G1)
Quality Score221
Status Validated
Chromosome11
Chromosomal Location32187541-32200279 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 32192654 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 295 (S295A)
Ref Sequence ENSEMBL: ENSMUSP00000119557 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020518] [ENSMUST00000128311] [ENSMUST00000142396] [ENSMUST00000145401]
Predicted Effect probably benign
Transcript: ENSMUST00000020518
SMART Domains Protein: ENSMUSP00000020518
Gene: ENSMUSG00000020279

DomainStartEndE-ValueType
SCOP:d1gh7a2 47 98 1e-3 SMART
Blast:FN3 49 95 4e-22 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000128311
AA Change: S295A

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119557
Gene: ENSMUSG00000020279
AA Change: S295A

DomainStartEndE-ValueType
PDB:4GS7|B 48 254 5e-6 PDB
SCOP:d1gh7a2 143 257 4e-11 SMART
Blast:FN3 146 229 5e-43 BLAST
transmembrane domain 270 292 N/A INTRINSIC
low complexity region 343 352 N/A INTRINSIC
low complexity region 420 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131979
Predicted Effect possibly damaging
Transcript: ENSMUST00000142396
AA Change: S300A

PolyPhen 2 Score 0.750 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119185
Gene: ENSMUSG00000020279
AA Change: S300A

DomainStartEndE-ValueType
PDB:4GS7|B 53 259 5e-6 PDB
SCOP:d1gh7a2 148 262 3e-11 SMART
Blast:FN3 151 234 5e-43 BLAST
transmembrane domain 275 297 N/A INTRINSIC
low complexity region 348 357 N/A INTRINSIC
low complexity region 425 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000145401
AA Change: S294A

PolyPhen 2 Score 0.778 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118204
Gene: ENSMUSG00000020279
AA Change: S294A

DomainStartEndE-ValueType
Blast:FN3 146 228 3e-42 BLAST
SCOP:d1egja_ 147 256 1e-10 SMART
transmembrane domain 269 291 N/A INTRINSIC
low complexity region 342 351 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that specifically mediates the biological effects of interleukin 9 (IL9). The functional IL9 receptor complex requires this protein as well as the interleukin 2 receptor, gamma (IL2RG), a common gamma subunit shared by the receptors of many different cytokines. The ligand binding of this receptor leads to the activation of various JAK kinases and STAT proteins, which connect to different biologic responses. This gene is located at the pseudoautosomal regions of X and Y chromosomes. Genetic studies suggested an association of this gene with the development of asthma. Multiple pseudogenes on chromosome 9, 10, 16, and 18 have been described. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are more susceptible to experimental autoimmune encephalomyelitis, a defect partially attributable to defective regulatory T cell function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 probably null Het
Abcc8 C A 7: 46,104,707 A1562S probably benign Het
Adam30 C A 3: 98,162,745 D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 A196V probably benign Het
Baiap3 T A 17: 25,247,295 probably benign Het
Bicra T C 7: 15,988,906 T229A possibly damaging Het
C1qbp A G 11: 70,982,364 probably benign Het
C2cd3 C A 7: 100,391,019 T265K probably benign Het
Cacna1s T A 1: 136,115,269 I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdcp2 A G 4: 107,106,772 Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 I39N probably damaging Het
Cep152 A C 2: 125,563,754 S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 I42T probably damaging Het
Cfap61 G T 2: 146,143,100 V955L probably damaging Het
Cit G A 5: 115,908,691 D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Cntn4 A T 6: 106,550,497 I447L probably benign Het
Csmd3 T C 15: 47,857,934 T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 K9E probably damaging Het
Dip2c T A 13: 9,575,150 M560K probably benign Het
Dsg1a A T 18: 20,333,722 T550S probably benign Het
Dtnb A G 12: 3,749,505 E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 probably benign Het
Efl1 T A 7: 82,671,719 V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 Y769C probably benign Het
Fcho2 T C 13: 98,806,366 Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 V294A probably damaging Het
Gls A G 1: 52,199,945 probably benign Het
Gm15130 A T 2: 111,135,369 probably benign Het
Gm6185 A T 1: 161,213,158 noncoding transcript Het
Gpr171 T A 3: 59,098,096 H86L probably damaging Het
Gpr179 T C 11: 97,339,248 T694A probably damaging Het
H2-Aa A T 17: 34,283,820 V124E probably damaging Het
H2-M5 A G 17: 36,989,417 probably benign Het
Hist1h2bl A G 13: 21,715,965 M60T probably benign Het
Igf2r A T 17: 12,684,097 N2355K probably damaging Het
Ipo9 T C 1: 135,406,550 T313A probably benign Het
Kalrn C T 16: 34,514,019 probably benign Het
Lama3 G A 18: 12,477,604 V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 C242* probably null Het
Lipe A G 7: 25,380,143 S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 T169I probably benign Het
Lrrc39 T C 3: 116,568,866 probably null Het
Lrrd1 T A 5: 3,851,126 L477* probably null Het
Lrriq4 A G 3: 30,660,047 I515V possibly damaging Het
Magel2 A G 7: 62,381,092 Y1248C unknown Het
Maml1 G T 11: 50,258,335 N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 H139L possibly damaging Het
Mef2d C T 3: 88,168,090 P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 K38E probably benign Het
Mtmr4 T C 11: 87,604,097 V405A probably damaging Het
Naip5 G A 13: 100,219,681 S1142F probably benign Het
Naip5 G A 13: 100,219,687 T1140M probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nfe2l3 T C 6: 51,456,624 S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 I235V probably benign Het
Nyap2 T A 1: 81,241,313 L318Q probably damaging Het
Nynrin G A 14: 55,872,001 V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 N74K probably benign Het
Olfr1461 A G 19: 13,165,124 I37V probably benign Het
Olfr659 C T 7: 104,670,735 P11L probably benign Het
Olfr810 T C 10: 129,791,439 D50G probably damaging Het
Olfr875 T A 9: 37,773,430 M257K possibly damaging Het
Oog3 A G 4: 144,159,161 L289P probably damaging Het
Pax6 T C 2: 105,683,784 probably benign Het
Pbrm1 G A 14: 31,110,448 R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 S747P probably benign Het
Pcnx3 A C 19: 5,687,995 probably null Het
Pds5a A T 5: 65,651,289 V413E probably damaging Het
Phpt1 G T 2: 25,574,320 probably benign Het
Phykpl A G 11: 51,592,953 E220G probably benign Het
Pias2 T C 18: 77,105,891 probably null Het
Pkhd1 T A 1: 20,199,415 I3302L probably damaging Het
Poli A G 18: 70,522,751 L241P probably damaging Het
Ppm1h T A 10: 122,679,379 I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 L954P probably damaging Het
Pxk T G 14: 8,136,893 M138R probably damaging Het
Rasl11b G T 5: 74,198,397 D188Y probably damaging Het
Rtraf A G 14: 19,822,576 F59S probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setdb2 G A 14: 59,413,646 T412I probably benign Het
Shank2 C A 7: 144,052,306 N75K probably damaging Het
Shank3 T A 15: 89,543,115 I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 N495S probably damaging Het
Smc2 A G 4: 52,451,231 T292A probably benign Het
Spag9 T C 11: 94,048,599 probably benign Het
Tas2r113 C T 6: 132,893,782 P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 S530G probably benign Het
Tenm2 A G 11: 36,027,290 V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 G147V possibly damaging Het
Trim38 A T 13: 23,788,281 E195V probably damaging Het
Try5 T C 6: 41,313,415 Y45C probably benign Het
Umad1 A C 6: 8,457,462 probably benign Het
Vmn2r105 T C 17: 20,208,691 I708V probably benign Het
Zc3h12d A T 10: 7,867,947 S494C probably damaging Het
Zeb2 A G 2: 44,997,768 S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 S1304G probably benign Het
Zfp287 G T 11: 62,714,248 T611K probably damaging Het
Zfp534 G A 4: 147,674,286 T642I possibly damaging Het
Other mutations in Il9r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03267:Il9r APN 11 32191778 missense possibly damaging 0.76
PIT4305001:Il9r UTSW 11 32194734 missense probably benign
PIT4651001:Il9r UTSW 11 32191798 missense probably benign 0.02
R1691:Il9r UTSW 11 32191829 missense possibly damaging 0.75
R1695:Il9r UTSW 11 32193227 missense probably benign 0.31
R5381:Il9r UTSW 11 32190715 missense probably benign 0.14
R5701:Il9r UTSW 11 32193263 missense probably benign 0.41
R6015:Il9r UTSW 11 32192674 missense probably benign 0.14
R6445:Il9r UTSW 11 32191000 missense possibly damaging 0.92
R6584:Il9r UTSW 11 32191782 missense probably benign 0.01
R6976:Il9r UTSW 11 32193177 nonsense probably null
R7171:Il9r UTSW 11 32192671 missense probably benign 0.15
R7326:Il9r UTSW 11 32194389 missense possibly damaging 0.78
R7948:Il9r UTSW 11 32194486 missense probably damaging 1.00
X0028:Il9r UTSW 11 32190793 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTATCCATTTACACCGTGGCC -3'
(R):5'- TTGGCTCAGAGAACTAGTGGTG -3'

Sequencing Primer
(F):5'- GTGGCCTGCATCCTTTTACAGAC -3'
(R):5'- ATAGACTCTCTCTGCCCA -3'
Posted On2016-02-04