Incidental Mutation 'R4816:Nlrp3'
ID 369823
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 042434-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R4816 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59439127 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 235 (I235V)
Ref Sequence ENSEMBL: ENSMUSP00000098707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect probably benign
Transcript: ENSMUST00000079476
AA Change: I235V

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: I235V

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101148
AA Change: I235V

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: I235V

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc8 C A 7: 45,754,131 (GRCm39) A1562S probably benign Het
Adam30 C A 3: 98,070,061 (GRCm39) D631E possibly damaging Het
Adgrv1 T C 13: 81,676,793 (GRCm39) T2013A probably damaging Het
Ark2n A T 18: 77,740,995 (GRCm39) probably null Het
Baiap3 T A 17: 25,466,269 (GRCm39) probably benign Het
Bicra T C 7: 15,722,831 (GRCm39) T229A possibly damaging Het
C1qbp A G 11: 70,873,190 (GRCm39) probably benign Het
C2cd3 C A 7: 100,040,226 (GRCm39) T265K probably benign Het
Cacna1s T A 1: 136,043,007 (GRCm39) I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,806,440 (GRCm39) probably null Het
Cdcp2 A G 4: 106,963,969 (GRCm39) Y273C probably damaging Het
Cdh23 A C 10: 60,244,856 (GRCm39) V1013G possibly damaging Het
Celf3 T A 3: 94,386,529 (GRCm39) I39N probably damaging Het
Cep152 A C 2: 125,405,674 (GRCm39) S1619R probably damaging Het
Cfap36 A G 11: 29,195,108 (GRCm39) I42T probably damaging Het
Cfap61 G T 2: 145,985,020 (GRCm39) V955L probably damaging Het
Cit G A 5: 116,046,750 (GRCm39) D388N probably damaging Het
Clca3a2 T C 3: 144,516,613 (GRCm39) M328V probably benign Het
Cntn4 A T 6: 106,527,458 (GRCm39) I447L probably benign Het
Csmd3 T C 15: 47,721,330 (GRCm39) T1538A possibly damaging Het
Cstf1 A G 2: 172,214,905 (GRCm39) K9E probably damaging Het
Dip2c T A 13: 9,625,186 (GRCm39) M560K probably benign Het
Dsg1a A T 18: 20,466,779 (GRCm39) T550S probably benign Het
Dtnb A G 12: 3,799,505 (GRCm39) E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,680,584 (GRCm39) probably benign Het
Efl1 T A 7: 82,320,927 (GRCm39) V120E probably damaging Het
Fbxl13 T C 5: 21,689,001 (GRCm39) Y769C probably benign Het
Fcho2 T C 13: 98,942,874 (GRCm39) Y22C probably damaging Het
Flacc1 G A 1: 58,709,567 (GRCm39) A196V probably benign Het
Gbp3 T C 3: 142,273,335 (GRCm39) V294A probably damaging Het
Gls A G 1: 52,239,104 (GRCm39) probably benign Het
Gm15130 A T 2: 110,965,714 (GRCm39) probably benign Het
Gm6185 A T 1: 161,040,728 (GRCm39) noncoding transcript Het
Gpr171 T A 3: 59,005,517 (GRCm39) H86L probably damaging Het
Gpr179 T C 11: 97,230,074 (GRCm39) T694A probably damaging Het
H2-Aa A T 17: 34,502,794 (GRCm39) V124E probably damaging Het
H2bc13 A G 13: 21,900,135 (GRCm39) M60T probably benign Het
H2-M5 A G 17: 37,300,309 (GRCm39) probably benign Het
Igf2r A T 17: 12,902,984 (GRCm39) N2355K probably damaging Het
Il9r A C 11: 32,142,654 (GRCm39) S295A possibly damaging Het
Ipo9 T C 1: 135,334,288 (GRCm39) T313A probably benign Het
Kalrn C T 16: 34,334,389 (GRCm39) probably benign Het
Lama3 G A 18: 12,610,661 (GRCm39) V1175M possibly damaging Het
Lhpp T A 7: 132,272,104 (GRCm39) C242* probably null Het
Lipe A G 7: 25,079,568 (GRCm39) S1013P probably damaging Het
Lrrc25 C T 8: 71,070,726 (GRCm39) T169I probably benign Het
Lrrc39 T C 3: 116,362,515 (GRCm39) probably null Het
Lrrd1 T A 5: 3,901,126 (GRCm39) L477* probably null Het
Lrriq4 A G 3: 30,714,196 (GRCm39) I515V possibly damaging Het
Magel2 A G 7: 62,030,840 (GRCm39) Y1248C unknown Het
Maml1 G T 11: 50,149,162 (GRCm39) N859K possibly damaging Het
Mdm1 A T 10: 117,982,782 (GRCm39) H139L possibly damaging Het
Mef2d C T 3: 88,075,397 (GRCm39) P420S possibly damaging Het
Mgat4b A G 11: 50,101,848 (GRCm39) K38E probably benign Het
Mtmr4 T C 11: 87,494,923 (GRCm39) V405A probably damaging Het
Naip5 G A 13: 100,356,195 (GRCm39) T1140M probably benign Het
Naip5 T C 13: 100,356,204 (GRCm39) Q1137R probably benign Het
Naip5 G A 13: 100,356,189 (GRCm39) S1142F probably benign Het
Nfe2l3 T C 6: 51,433,604 (GRCm39) S239P probably damaging Het
Nyap2 T A 1: 81,219,028 (GRCm39) L318Q probably damaging Het
Nynrin G A 14: 56,109,458 (GRCm39) V1522M probably damaging Het
Oog3 A G 4: 143,885,731 (GRCm39) L289P probably damaging Het
Or52n20 C T 7: 104,319,942 (GRCm39) P11L probably benign Het
Or5b107 A G 19: 13,142,488 (GRCm39) I37V probably benign Het
Or6c69b T C 10: 129,627,308 (GRCm39) D50G probably damaging Het
Or8b12b T A 9: 37,684,726 (GRCm39) M257K possibly damaging Het
Or9g20 A T 2: 85,630,391 (GRCm39) N74K probably benign Het
Pax6 T C 2: 105,514,129 (GRCm39) probably benign Het
Pbrm1 G A 14: 30,832,405 (GRCm39) R1441K probably benign Het
Pcdha9 C T 18: 37,132,511 (GRCm39) R527W probably damaging Het
Pcdhb17 T C 18: 37,620,450 (GRCm39) S747P probably benign Het
Pcnx3 A C 19: 5,738,023 (GRCm39) probably null Het
Pds5a A T 5: 65,808,632 (GRCm39) V413E probably damaging Het
Phpt1 G T 2: 25,464,332 (GRCm39) probably benign Het
Phykpl A G 11: 51,483,780 (GRCm39) E220G probably benign Het
Pias2 T C 18: 77,193,587 (GRCm39) probably null Het
Pkhd1 T A 1: 20,269,639 (GRCm39) I3302L probably damaging Het
Poli A G 18: 70,655,822 (GRCm39) L241P probably damaging Het
Ppm1h T A 10: 122,515,284 (GRCm39) I65N possibly damaging Het
Ptpn14 T C 1: 189,588,997 (GRCm39) L954P probably damaging Het
Pxk T G 14: 8,136,893 (GRCm38) M138R probably damaging Het
Rasl11b G T 5: 74,359,058 (GRCm39) D188Y probably damaging Het
Rtraf A G 14: 19,872,644 (GRCm39) F59S probably benign Het
Sanbr A C 11: 23,565,243 (GRCm39) I248S possibly damaging Het
Serpinb5 G T 1: 106,800,069 (GRCm39) L86F probably damaging Het
Setdb2 G A 14: 59,651,095 (GRCm39) T412I probably benign Het
Shank2 C A 7: 143,606,043 (GRCm39) N75K probably damaging Het
Shank3 T A 15: 89,427,318 (GRCm39) I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 (GRCm39) M213L possibly damaging Het
Slc25a21 T C 12: 56,760,623 (GRCm39) Y298C probably damaging Het
Slc34a2 A G 5: 53,226,362 (GRCm39) N495S probably damaging Het
Smc2 A G 4: 52,451,231 (GRCm39) T292A probably benign Het
Spag9 T C 11: 93,939,425 (GRCm39) probably benign Het
Tas2r113 C T 6: 132,870,745 (GRCm39) P258S probably benign Het
Tbkbp1 T C 11: 97,029,567 (GRCm39) S530G probably benign Het
Tenm2 A G 11: 35,918,117 (GRCm39) V1881A probably damaging Het
Tm9sf1 C T 14: 55,878,606 (GRCm39) R262Q possibly damaging Het
Tmcc3 G T 10: 94,414,646 (GRCm39) G147V possibly damaging Het
Trim38 A T 13: 23,972,264 (GRCm39) E195V probably damaging Het
Try5 T C 6: 41,290,349 (GRCm39) Y45C probably benign Het
Umad1 A C 6: 8,457,462 (GRCm39) probably benign Het
Vmn2r105 T C 17: 20,428,953 (GRCm39) I708V probably benign Het
Zc3h12d A T 10: 7,743,711 (GRCm39) S494C probably damaging Het
Zeb2 A G 2: 44,887,780 (GRCm39) S382P probably damaging Het
Zfc3h1 A G 10: 115,251,599 (GRCm39) S1304G probably benign Het
Zfp287 G T 11: 62,605,074 (GRCm39) T611K probably damaging Het
Zfp534 G A 4: 147,758,743 (GRCm39) T642I possibly damaging Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1654:Nlrp3 UTSW 11 59,433,949 (GRCm39) missense probably benign 0.03
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGTGTGGACCTCAACAGTCG -3'
(R):5'- AAGGCTTGCGCAGGATCTTG -3'

Sequencing Primer
(F):5'- TCCAACTGGTCAAGGAGCATC -3'
(R):5'- TTGCGCAGGATCTTGCACAC -3'
Posted On 2016-02-04