Mutagenetix > Incidental Mutation

Incidental Mutation 'R4816:Spag9'

369827

Institutional Source

Beutler Lab

Gene Symbol

Spag9

Ensembl Gene

ENSMUSG00000020859

Gene Name

sperm associated antigen 9

Synonyms

syd1, JIP4, Mapk8ip4, 4733401I23Rik, JLP, 3110018C07Rik, 4831406C20Rik

MMRRC Submission

042434-MU

Accession Numbers

Genbank: NM_027569; MGI: 1918084

Essential gene?

Probably essential (E-score: 0.794) question?

Stock #

R4816 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

93996091-94126085 bp(+) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to C at 94048599 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024979] [ENSMUST00000041956] [ENSMUST00000075695] [ENSMUST00000092777] [ENSMUST00000103168] [ENSMUST00000132079]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000024979

SMART Domains

Protein: ENSMUSP00000024979
Gene: ENSMUSG00000020859

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	253	305	1e-25	PDB
low complexity region	306	339	N/A	INTRINSIC
coiled coil region	572	606	N/A	INTRINSIC
low complexity region	735	751	N/A	INTRINSIC
SCOP:d1kb0a2	823	969	3e-5	SMART
Blast:WD40	924	964	8e-18	BLAST
low complexity region	1132	1150	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000041956

SMART Domains

Protein: ENSMUSP00000042271
Gene: ENSMUSG00000020859

Domain	Start	End	E-Value	Type
Pfam:Jnk-SapK_ap_N	24	179	2e-61	PFAM
Pfam:JIP_LZII	390	460	5.3e-32	PFAM
coiled coil region	710	744	N/A	INTRINSIC
low complexity region	873	889	N/A	INTRINSIC
SCOP:d1kb0a2	961	1107	1e-5	SMART
Blast:WD40	1062	1102	1e-17	BLAST
low complexity region	1270	1288	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000075695

SMART Domains

Protein: ENSMUSP00000075115
Gene: ENSMUSG00000020859

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	253	305	1e-25	PDB
low complexity region	306	339	N/A	INTRINSIC
coiled coil region	571	605	N/A	INTRINSIC
low complexity region	734	750	N/A	INTRINSIC
SCOP:d1kb0a2	822	968	3e-5	SMART
Blast:WD40	923	963	7e-18	BLAST
low complexity region	1131	1149	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000092777

SMART Domains

Protein: ENSMUSP00000090452
Gene: ENSMUSG00000020859

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	254	306	1e-25	PDB
low complexity region	307	340	N/A	INTRINSIC
coiled coil region	572	606	N/A	INTRINSIC
low complexity region	735	751	N/A	INTRINSIC
SCOP:d1kb0a2	823	969	3e-5	SMART
Blast:WD40	924	964	7e-18	BLAST
low complexity region	1132	1150	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103168

SMART Domains

Protein: ENSMUSP00000099457
Gene: ENSMUSG00000020859

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
PDB:2W83\|D	249	301	1e-25	PDB
low complexity region	302	335	N/A	INTRINSIC
coiled coil region	567	601	N/A	INTRINSIC
low complexity region	730	746	N/A	INTRINSIC
SCOP:d1kb0a2	818	964	3e-5	SMART
Blast:WD40	919	959	8e-18	BLAST
low complexity region	1127	1145	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127066

Predicted Effect

probably benign
Transcript: ENSMUST00000132079

SMART Domains

Protein: ENSMUSP00000118850
Gene: ENSMUSG00000020859

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
coiled coil region	360	394	N/A	INTRINSIC
low complexity region	523	539	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132605

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132772

Predicted Effect

probably benign
Transcript: ENSMUST00000156019

SMART Domains

Protein: ENSMUSP00000115864
Gene: ENSMUSG00000020859

Domain	Start	End	E-Value	Type
Pfam:JIP_LZII	240	310	1.1e-32	PFAM
coiled coil region	559	593	N/A	INTRINSIC
low complexity region	723	739	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (113/116)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cancer testis antigen gene family. The encoded protein functions as a scaffold protein that structurally organizes mitogen-activated protein kinases and mediates c-Jun-terminal kinase signaling. This protein also binds to kinesin-1 and may be involved in microtubule-based membrane transport. This protein may play a role in tumor growth and development. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
PHENOTYPE: Male mice homozygous for a null mutation display reduced fertility with oligoasthenozoospermia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Gene trapped(4)

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,615,243	I248S	possibly damaging	Het
8030462N17Rik	A	T	18: 77,653,299		probably null	Het
Abcc8	C	A	7: 46,104,707	A1562S	probably benign	Het
Adam30	C	A	3: 98,162,745	D631E	possibly damaging	Het
Adgrv1	T	C	13: 81,528,674	T2013A	probably damaging	Het
Als2cr12	G	A	1: 58,670,408	A196V	probably benign	Het
Baiap3	T	A	17: 25,247,295		probably benign	Het
Bicra	T	C	7: 15,988,906	T229A	possibly damaging	Het
C1qbp	A	G	11: 70,982,364		probably benign	Het
C2cd3	C	A	7: 100,391,019	T265K	probably benign	Het
Cacna1s	T	A	1: 136,115,269	I1331K	possibly damaging	Het
Cdadc1	AGACGGA	AGA	14: 59,568,991		probably null	Het
Cdcp2	A	G	4: 107,106,772	Y273C	probably damaging	Het
Cdh23	A	C	10: 60,409,077	V1013G	possibly damaging	Het
Celf3	T	A	3: 94,479,222	I39N	probably damaging	Het
Cep152	A	C	2: 125,563,754	S1619R	probably damaging	Het
Cfap36	A	G	11: 29,245,108	I42T	probably damaging	Het
Cfap61	G	T	2: 146,143,100	V955L	probably damaging	Het
Cit	G	A	5: 115,908,691	D388N	probably damaging	Het
Clca3a2	T	C	3: 144,810,852	M328V	probably benign	Het
Cntn4	A	T	6: 106,550,497	I447L	probably benign	Het
Csmd3	T	C	15: 47,857,934	T1538A	possibly damaging	Het
Cstf1	A	G	2: 172,372,985	K9E	probably damaging	Het
Dip2c	T	A	13: 9,575,150	M560K	probably benign	Het
Dsg1a	A	T	18: 20,333,722	T550S	probably benign	Het
Dtnb	A	G	12: 3,749,505	E460G	probably damaging	Het
Dus1l	GAGGTAAG	GAG	11: 120,789,758		probably benign	Het
Efl1	T	A	7: 82,671,719	V120E	probably damaging	Het
Fbxl13	T	C	5: 21,484,003	Y769C	probably benign	Het
Fcho2	T	C	13: 98,806,366	Y22C	probably damaging	Het
Gbp3	T	C	3: 142,567,574	V294A	probably damaging	Het
Gls	A	G	1: 52,199,945		probably benign	Het
Gm15130	A	T	2: 111,135,369		probably benign	Het
Gm6185	A	T	1: 161,213,158		noncoding transcript	Het
Gpr171	T	A	3: 59,098,096	H86L	probably damaging	Het
Gpr179	T	C	11: 97,339,248	T694A	probably damaging	Het
H2-Aa	A	T	17: 34,283,820	V124E	probably damaging	Het
H2-M5	A	G	17: 36,989,417		probably benign	Het
Hist1h2bl	A	G	13: 21,715,965	M60T	probably benign	Het
Igf2r	A	T	17: 12,684,097	N2355K	probably damaging	Het
Il9r	A	C	11: 32,192,654	S295A	possibly damaging	Het
Ipo9	T	C	1: 135,406,550	T313A	probably benign	Het
Kalrn	C	T	16: 34,514,019		probably benign	Het
Lama3	G	A	18: 12,477,604	V1175M	possibly damaging	Het
Lhpp	T	A	7: 132,670,375	C242*	probably null	Het
Lipe	A	G	7: 25,380,143	S1013P	probably damaging	Het
Lrrc25	C	T	8: 70,618,076	T169I	probably benign	Het
Lrrc39	T	C	3: 116,568,866		probably null	Het
Lrrd1	T	A	5: 3,851,126	L477*	probably null	Het
Lrriq4	A	G	3: 30,660,047	I515V	possibly damaging	Het
Magel2	A	G	7: 62,381,092	Y1248C	unknown	Het
Maml1	G	T	11: 50,258,335	N859K	possibly damaging	Het
Mdm1	A	T	10: 118,146,877	H139L	possibly damaging	Het
Mef2d	C	T	3: 88,168,090	P420S	possibly damaging	Het
Mgat4b	A	G	11: 50,211,021	K38E	probably benign	Het
Mtmr4	T	C	11: 87,604,097	V405A	probably damaging	Het
Naip5	G	A	13: 100,219,681	S1142F	probably benign	Het
Naip5	G	A	13: 100,219,687	T1140M	probably benign	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Nfe2l3	T	C	6: 51,456,624	S239P	probably damaging	Het
Nlrp3	A	G	11: 59,548,301	I235V	probably benign	Het
Nyap2	T	A	1: 81,241,313	L318Q	probably damaging	Het
Nynrin	G	A	14: 55,872,001	V1522M	probably damaging	Het
Olfr1016	A	T	2: 85,800,047	N74K	probably benign	Het
Olfr1461	A	G	19: 13,165,124	I37V	probably benign	Het
Olfr659	C	T	7: 104,670,735	P11L	probably benign	Het
Olfr810	T	C	10: 129,791,439	D50G	probably damaging	Het
Olfr875	T	A	9: 37,773,430	M257K	possibly damaging	Het
Oog3	A	G	4: 144,159,161	L289P	probably damaging	Het
Pax6	T	C	2: 105,683,784		probably benign	Het
Pbrm1	G	A	14: 31,110,448	R1441K	probably benign	Het
Pcdha9	C	T	18: 36,999,458	R527W	probably damaging	Het
Pcdhb17	T	C	18: 37,487,397	S747P	probably benign	Het
Pcnx3	A	C	19: 5,687,995		probably null	Het
Pds5a	A	T	5: 65,651,289	V413E	probably damaging	Het
Phpt1	G	T	2: 25,574,320		probably benign	Het
Phykpl	A	G	11: 51,592,953	E220G	probably benign	Het
Pias2	T	C	18: 77,105,891		probably null	Het
Pkhd1	T	A	1: 20,199,415	I3302L	probably damaging	Het
Poli	A	G	18: 70,522,751	L241P	probably damaging	Het
Ppm1h	T	A	10: 122,679,379	I65N	possibly damaging	Het
Ptpn14	T	C	1: 189,856,800	L954P	probably damaging	Het
Pxk	T	G	14: 8,136,893	M138R	probably damaging	Het
Rasl11b	G	T	5: 74,198,397	D188Y	probably damaging	Het
Rtraf	A	G	14: 19,822,576	F59S	probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Setdb2	G	A	14: 59,413,646	T412I	probably benign	Het
Shank2	C	A	7: 144,052,306	N75K	probably damaging	Het
Shank3	T	A	15: 89,543,115	I791N	probably damaging	Het
Slc25a13	T	A	6: 6,114,274	M213L	possibly damaging	Het
Slc25a21	T	C	12: 56,713,838	Y298C	probably damaging	Het
Slc34a2	A	G	5: 53,069,020	N495S	probably damaging	Het
Smc2	A	G	4: 52,451,231	T292A	probably benign	Het
Tas2r113	C	T	6: 132,893,782	P258S	probably benign	Het
Tbkbp1	T	C	11: 97,138,741	S530G	probably benign	Het
Tenm2	A	G	11: 36,027,290	V1881A	probably damaging	Het
Tm9sf1	C	T	14: 55,641,149	R262Q	possibly damaging	Het
Tmcc3	G	T	10: 94,578,784	G147V	possibly damaging	Het
Trim38	A	T	13: 23,788,281	E195V	probably damaging	Het
Try5	T	C	6: 41,313,415	Y45C	probably benign	Het
Umad1	A	C	6: 8,457,462		probably benign	Het
Vmn2r105	T	C	17: 20,208,691	I708V	probably benign	Het
Zc3h12d	A	T	10: 7,867,947	S494C	probably damaging	Het
Zeb2	A	G	2: 44,997,768	S382P	probably damaging	Het
Zfc3h1	A	G	10: 115,415,694	S1304G	probably benign	Het
Zfp287	G	T	11: 62,714,248	T611K	probably damaging	Het
Zfp534	G	A	4: 147,674,286	T642I	possibly damaging	Het

Other mutations in Spag9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Spag9	APN	11	94097866	missense	probably benign	0.02
IGL01776:Spag9	APN	11	94116727	splice site	probably benign
IGL02095:Spag9	APN	11	94108582	missense	probably damaging	1.00
IGL02307:Spag9	APN	11	94102160	critical splice donor site	probably null
IGL02417:Spag9	APN	11	94116741	missense	probably benign	0.27
IGL02480:Spag9	APN	11	94108587	nonsense	probably null
IGL02864:Spag9	APN	11	94106661	missense	probably damaging	1.00
IGL02976:Spag9	APN	11	94083953	missense	probably benign	0.30
IGL02979:Spag9	APN	11	94097364	missense	probably benign
IGL03349:Spag9	APN	11	94093509	missense	possibly damaging	0.51
dazzle	UTSW	11	94093624	nonsense	probably null
R0128:Spag9	UTSW	11	94093539	missense	probably damaging	1.00
R0418:Spag9	UTSW	11	94091753	splice site	probably benign
R1463:Spag9	UTSW	11	94116837	missense	probably damaging	1.00
R1593:Spag9	UTSW	11	94097233	missense	probably damaging	1.00
R1605:Spag9	UTSW	11	94048539	missense	probably damaging	0.99
R1649:Spag9	UTSW	11	94108452	splice site	probably null
R1697:Spag9	UTSW	11	93996565	missense	probably benign	0.00
R1952:Spag9	UTSW	11	94097358	missense	possibly damaging	0.77
R2011:Spag9	UTSW	11	94092375	nonsense	probably null
R2012:Spag9	UTSW	11	94092375	nonsense	probably null
R2351:Spag9	UTSW	11	94092900	missense	probably damaging	1.00
R2367:Spag9	UTSW	11	94116757	missense	probably damaging	1.00
R3027:Spag9	UTSW	11	94086377	missense	probably null	1.00
R3766:Spag9	UTSW	11	94060283	intron	probably benign
R3777:Spag9	UTSW	11	94099026	critical splice acceptor site	probably null
R3937:Spag9	UTSW	11	94044417	missense	possibly damaging	0.94
R3937:Spag9	UTSW	11	94044479	missense	possibly damaging	0.92
R4417:Spag9	UTSW	11	94060346	intron	probably benign
R4445:Spag9	UTSW	11	94097253	missense	possibly damaging	0.95
R4711:Spag9	UTSW	11	94114351	critical splice donor site	probably null
R4799:Spag9	UTSW	11	94048516	missense	possibly damaging	0.87
R4799:Spag9	UTSW	11	94048517	missense	probably damaging	0.96
R4843:Spag9	UTSW	11	94097818	missense	probably damaging	1.00
R5020:Spag9	UTSW	11	94097786	missense	probably benign	0.08
R5119:Spag9	UTSW	11	94122722	missense	probably damaging	1.00
R5298:Spag9	UTSW	11	94100135	missense	probably damaging	1.00
R5304:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5305:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5395:Spag9	UTSW	11	94091751	splice site	probably null
R5636:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5638:Spag9	UTSW	11	94069012	missense	probably damaging	1.00
R5654:Spag9	UTSW	11	94090712	missense	probably damaging	1.00
R5779:Spag9	UTSW	11	94114253	missense	probably benign	0.20
R5814:Spag9	UTSW	11	94082828	missense	possibly damaging	0.94
R5912:Spag9	UTSW	11	94044425	missense	probably damaging	0.98
R6038:Spag9	UTSW	11	94112092	missense	probably damaging	1.00
R6038:Spag9	UTSW	11	94112092	missense	probably damaging	1.00
R6269:Spag9	UTSW	11	94044507	missense	probably benign	0.05
R6294:Spag9	UTSW	11	94093485	critical splice acceptor site	probably null
R6389:Spag9	UTSW	11	94086311	missense	probably damaging	1.00
R6420:Spag9	UTSW	11	94086302	missense	probably damaging	1.00
R6460:Spag9	UTSW	11	94068975	missense	probably damaging	1.00
R6482:Spag9	UTSW	11	94093502	missense	possibly damaging	0.94
R6860:Spag9	UTSW	11	94081370	missense	probably benign	0.25
R7086:Spag9	UTSW	11	94097864	missense	probably benign
R7179:Spag9	UTSW	11	94089432	splice site	probably null
R7225:Spag9	UTSW	11	94097358	missense	probably damaging	0.98
R7351:Spag9	UTSW	11	94092976	missense	probably benign	0.00
R7366:Spag9	UTSW	11	94108521	missense	possibly damaging	0.56
R7378:Spag9	UTSW	11	94114351	critical splice donor site	probably null
R7401:Spag9	UTSW	11	94097689	missense	probably benign
R7506:Spag9	UTSW	11	94108464	missense	probably damaging	1.00
R7507:Spag9	UTSW	11	94068080	missense	probably benign	0.00
R7513:Spag9	UTSW	11	94112083	missense	probably damaging	1.00
R7655:Spag9	UTSW	11	93996563	missense	possibly damaging	0.56
R7656:Spag9	UTSW	11	93996563	missense	possibly damaging	0.56
R7664:Spag9	UTSW	11	94102160	critical splice donor site	probably null
R7665:Spag9	UTSW	11	94013654	missense	probably damaging	0.98
R7862:Spag9	UTSW	11	94112066	missense	possibly damaging	0.69
R8074:Spag9	UTSW	11	94112051	missense	probably damaging	1.00
R8085:Spag9	UTSW	11	94099044	missense	probably benign
R8469:Spag9	UTSW	11	94091801	missense	probably damaging	1.00
R8547:Spag9	UTSW	11	94122821	missense	possibly damaging	0.84
R8709:Spag9	UTSW	11	94068090	missense	probably benign	0.02
R8732:Spag9	UTSW	11	94071688	critical splice donor site	probably null
R8899:Spag9	UTSW	11	94092869	missense	probably damaging	1.00
R8983:Spag9	UTSW	11	94067989	missense	probably benign
R9043:Spag9	UTSW	11	94060259	missense
R9050:Spag9	UTSW	11	94044468	missense	probably damaging	0.97
R9502:Spag9	UTSW	11	94068966	missense	probably damaging	1.00
R9575:Spag9	UTSW	11	94071583	missense	probably damaging	0.99
R9667:Spag9	UTSW	11	93996293	missense	possibly damaging	0.83
R9683:Spag9	UTSW	11	94097742	missense	probably damaging	1.00
R9774:Spag9	UTSW	11	94114236	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TTTTCTATCCACAGCCCAGG -3'
(R):5'- TGTGAACTACAGTCACTGTGG -3'

Sequencing Primer
(F):5'- ACGTCCTATATCATTAGGGATTTTCC -3'
(R):5'- CTACAGTCACTGTGGTTCTGTAGAG -3'

Posted On

2016-02-04