Incidental Mutation 'R4816:Dtnb'
ID369831
Institutional Source Beutler Lab
Gene Symbol Dtnb
Ensembl Gene ENSMUSG00000071454
Gene Namedystrobrevin, beta
Synonyms
MMRRC Submission 042434-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4816 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location3572381-3781796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3749505 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 460 (E460G)
Ref Sequence ENSEMBL: ENSMUSP00000134146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077930] [ENSMUST00000101637] [ENSMUST00000164578] [ENSMUST00000164607] [ENSMUST00000173199] [ENSMUST00000173240] [ENSMUST00000173483] [ENSMUST00000173542] [ENSMUST00000173736] [ENSMUST00000174109] [ENSMUST00000174290] [ENSMUST00000174547] [ENSMUST00000174639] [ENSMUST00000174663]
Predicted Effect probably damaging
Transcript: ENSMUST00000077930
AA Change: E460G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077085
Gene: ENSMUSG00000071454
AA Change: E460G

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.7e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101637
AA Change: E460G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099161
Gene: ENSMUSG00000071454
AA Change: E460G

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.1e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 8e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164578
AA Change: E460G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126194
Gene: ENSMUSG00000071454
AA Change: E460G

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 7.9e-38 PFAM
Pfam:EF-hand_3 144 232 2.1e-33 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164607
AA Change: E460G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000128230
Gene: ENSMUSG00000071454
AA Change: E460G

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.1e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 403 416 N/A INTRINSIC
coiled coil region 429 519 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172504
Predicted Effect unknown
Transcript: ENSMUST00000172598
AA Change: E273G
SMART Domains Protein: ENSMUSP00000134124
Gene: ENSMUSG00000071454
AA Change: E273G

DomainStartEndE-ValueType
Pfam:EF-hand_3 1 46 7.7e-15 PFAM
ZnF_ZZ 51 96 3.29e-15 SMART
low complexity region 217 230 N/A INTRINSIC
coiled coil region 242 332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173199
AA Change: E460G

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134392
Gene: ENSMUSG00000071454
AA Change: E460G

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.6e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 9e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173240
AA Change: E430G

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133722
Gene: ENSMUSG00000071454
AA Change: E430G

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
SCOP:d1eq1a_ 404 494 8e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173483
SMART Domains Protein: ENSMUSP00000134390
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 61 7.9e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173498
Predicted Effect probably benign
Transcript: ENSMUST00000173542
SMART Domains Protein: ENSMUSP00000134036
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
coiled coil region 1 55 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173736
AA Change: E430G

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134519
Gene: ENSMUSG00000071454
AA Change: E430G

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 1.8e-40 PFAM
Pfam:EF-hand_3 144 232 1.3e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
low complexity region 373 386 N/A INTRINSIC
coiled coil region 399 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173847
Predicted Effect probably benign
Transcript: ENSMUST00000174109
SMART Domains Protein: ENSMUSP00000134151
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 132 1.1e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174290
SMART Domains Protein: ENSMUSP00000133697
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 6e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174547
AA Change: E460G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133927
Gene: ENSMUSG00000071454
AA Change: E460G

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2e-40 PFAM
Pfam:EF-hand_3 144 232 1.4e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174639
SMART Domains Protein: ENSMUSP00000133601
Gene: ENSMUSG00000071454

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 123 6.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174663
AA Change: E460G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134146
Gene: ENSMUSG00000071454
AA Change: E460G

DomainStartEndE-ValueType
Pfam:EF-hand_2 14 140 2.2e-40 PFAM
Pfam:EF-hand_3 144 232 1.5e-38 PFAM
ZnF_ZZ 237 282 3.29e-15 SMART
SCOP:d1eq1a_ 364 524 4e-4 SMART
Meta Mutation Damage Score 0.1177 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes dystrobrevin beta, a component of the dystrophin-associated protein complex (DPC). The DPC consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and dystrobrevin alpha and beta. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Dystrobrevin beta is thought to interact with syntrophin and the DP71 short form of dystrophin. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile and show no obvious histological or functional abnormalities in liver and kidney. Mice homozygous for a gene trapped allele are viable, fertile and overtly normal with no significant synaptic or behavioral defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 probably null Het
Abcc8 C A 7: 46,104,707 A1562S probably benign Het
Adam30 C A 3: 98,162,745 D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 A196V probably benign Het
Baiap3 T A 17: 25,247,295 probably benign Het
Bicra T C 7: 15,988,906 T229A possibly damaging Het
C1qbp A G 11: 70,982,364 probably benign Het
C2cd3 C A 7: 100,391,019 T265K probably benign Het
Cacna1s T A 1: 136,115,269 I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdcp2 A G 4: 107,106,772 Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 I39N probably damaging Het
Cep152 A C 2: 125,563,754 S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 I42T probably damaging Het
Cfap61 G T 2: 146,143,100 V955L probably damaging Het
Cit G A 5: 115,908,691 D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Cntn4 A T 6: 106,550,497 I447L probably benign Het
Csmd3 T C 15: 47,857,934 T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 K9E probably damaging Het
Dip2c T A 13: 9,575,150 M560K probably benign Het
Dsg1a A T 18: 20,333,722 T550S probably benign Het
Dus1l GAGGTAAG GAG 11: 120,789,758 probably benign Het
Efl1 T A 7: 82,671,719 V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 Y769C probably benign Het
Fcho2 T C 13: 98,806,366 Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 V294A probably damaging Het
Gls A G 1: 52,199,945 probably benign Het
Gm15130 A T 2: 111,135,369 probably benign Het
Gm6185 A T 1: 161,213,158 noncoding transcript Het
Gpr171 T A 3: 59,098,096 H86L probably damaging Het
Gpr179 T C 11: 97,339,248 T694A probably damaging Het
H2-Aa A T 17: 34,283,820 V124E probably damaging Het
H2-M5 A G 17: 36,989,417 probably benign Het
Hist1h2bl A G 13: 21,715,965 M60T probably benign Het
Igf2r A T 17: 12,684,097 N2355K probably damaging Het
Il9r A C 11: 32,192,654 S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 T313A probably benign Het
Kalrn C T 16: 34,514,019 probably benign Het
Lama3 G A 18: 12,477,604 V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 C242* probably null Het
Lipe A G 7: 25,380,143 S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 T169I probably benign Het
Lrrc39 T C 3: 116,568,866 probably null Het
Lrrd1 T A 5: 3,851,126 L477* probably null Het
Lrriq4 A G 3: 30,660,047 I515V possibly damaging Het
Magel2 A G 7: 62,381,092 Y1248C unknown Het
Maml1 G T 11: 50,258,335 N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 H139L possibly damaging Het
Mef2d C T 3: 88,168,090 P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 K38E probably benign Het
Mtmr4 T C 11: 87,604,097 V405A probably damaging Het
Naip5 G A 13: 100,219,681 S1142F probably benign Het
Naip5 G A 13: 100,219,687 T1140M probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nfe2l3 T C 6: 51,456,624 S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 I235V probably benign Het
Nyap2 T A 1: 81,241,313 L318Q probably damaging Het
Nynrin G A 14: 55,872,001 V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 N74K probably benign Het
Olfr1461 A G 19: 13,165,124 I37V probably benign Het
Olfr659 C T 7: 104,670,735 P11L probably benign Het
Olfr810 T C 10: 129,791,439 D50G probably damaging Het
Olfr875 T A 9: 37,773,430 M257K possibly damaging Het
Oog3 A G 4: 144,159,161 L289P probably damaging Het
Pax6 T C 2: 105,683,784 probably benign Het
Pbrm1 G A 14: 31,110,448 R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 S747P probably benign Het
Pcnx3 A C 19: 5,687,995 probably null Het
Pds5a A T 5: 65,651,289 V413E probably damaging Het
Phpt1 G T 2: 25,574,320 probably benign Het
Phykpl A G 11: 51,592,953 E220G probably benign Het
Pias2 T C 18: 77,105,891 probably null Het
Pkhd1 T A 1: 20,199,415 I3302L probably damaging Het
Poli A G 18: 70,522,751 L241P probably damaging Het
Ppm1h T A 10: 122,679,379 I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 L954P probably damaging Het
Pxk T G 14: 8,136,893 M138R probably damaging Het
Rasl11b G T 5: 74,198,397 D188Y probably damaging Het
Rtraf A G 14: 19,822,576 F59S probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setdb2 G A 14: 59,413,646 T412I probably benign Het
Shank2 C A 7: 144,052,306 N75K probably damaging Het
Shank3 T A 15: 89,543,115 I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 N495S probably damaging Het
Smc2 A G 4: 52,451,231 T292A probably benign Het
Spag9 T C 11: 94,048,599 probably benign Het
Tas2r113 C T 6: 132,893,782 P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 S530G probably benign Het
Tenm2 A G 11: 36,027,290 V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 G147V possibly damaging Het
Trim38 A T 13: 23,788,281 E195V probably damaging Het
Try5 T C 6: 41,313,415 Y45C probably benign Het
Umad1 A C 6: 8,457,462 probably benign Het
Vmn2r105 T C 17: 20,208,691 I708V probably benign Het
Zc3h12d A T 10: 7,867,947 S494C probably damaging Het
Zeb2 A G 2: 44,997,768 S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 S1304G probably benign Het
Zfp287 G T 11: 62,714,248 T611K probably damaging Het
Zfp534 G A 4: 147,674,286 T642I possibly damaging Het
Other mutations in Dtnb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01866:Dtnb APN 12 3732626 missense probably benign 0.00
IGL02269:Dtnb APN 12 3596691 missense probably damaging 1.00
IGL02710:Dtnb APN 12 3648380 missense possibly damaging 0.93
R0004:Dtnb UTSW 12 3596635 splice site probably benign
R0449:Dtnb UTSW 12 3591971 nonsense probably null
R0601:Dtnb UTSW 12 3735039 splice site probably benign
R1242:Dtnb UTSW 12 3732627 nonsense probably null
R1582:Dtnb UTSW 12 3773554 missense possibly damaging 0.78
R1719:Dtnb UTSW 12 3643936 nonsense probably null
R1960:Dtnb UTSW 12 3781190 missense probably benign 0.34
R2073:Dtnb UTSW 12 3781273 missense probably benign
R2074:Dtnb UTSW 12 3781273 missense probably benign
R3423:Dtnb UTSW 12 3591962 nonsense probably null
R3708:Dtnb UTSW 12 3589156 splice site probably null
R4788:Dtnb UTSW 12 3772699 missense probably damaging 1.00
R5086:Dtnb UTSW 12 3632942 missense probably benign 0.19
R5725:Dtnb UTSW 12 3773566 missense probably damaging 1.00
R6724:Dtnb UTSW 12 3686817 missense probably damaging 1.00
R6835:Dtnb UTSW 12 3632841 intron probably benign
R6912:Dtnb UTSW 12 3648221 critical splice acceptor site probably null
R7078:Dtnb UTSW 12 3748480 missense possibly damaging 0.80
R7105:Dtnb UTSW 12 3648391 critical splice donor site probably null
R7408:Dtnb UTSW 12 3644272 intron probably null
R7538:Dtnb UTSW 12 3773611 missense possibly damaging 0.80
X0026:Dtnb UTSW 12 3686814 missense probably damaging 1.00
X0060:Dtnb UTSW 12 3596690 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGAAAAGAACGTCACCAGTGG -3'
(R):5'- GTTCTGACGTCAGGTTCTACTG -3'

Sequencing Primer
(F):5'- CCTCAGGAGCCATCAGGTGAAG -3'
(R):5'- GGTTCTACTGATGAACAGATTCTGTC -3'
Posted On2016-02-04