Incidental Mutation 'R4816:Dip2c'
ID 369833
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Name disco interacting protein 2 homolog C
Synonyms 2900024P20Rik
MMRRC Submission 042434-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.711) question?
Stock # R4816 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 9276528-9668928 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9575150 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 560 (M560K)
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
AlphaFold E9PWR4
Predicted Effect probably benign
Transcript: ENSMUST00000166299
AA Change: M560K

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: M560K

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174552
AA Change: M560K

PolyPhen 2 Score 0.365 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: M560K

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Meta Mutation Damage Score 0.7673 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 (GRCm38) I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 (GRCm38) probably null Het
Abcc8 C A 7: 46,104,707 (GRCm38) A1562S probably benign Het
Adam30 C A 3: 98,162,745 (GRCm38) D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 (GRCm38) T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 (GRCm38) A196V probably benign Het
Baiap3 T A 17: 25,247,295 (GRCm38) probably benign Het
Bicra T C 7: 15,988,906 (GRCm38) T229A possibly damaging Het
C1qbp A G 11: 70,982,364 (GRCm38) probably benign Het
C2cd3 C A 7: 100,391,019 (GRCm38) T265K probably benign Het
Cacna1s T A 1: 136,115,269 (GRCm38) I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 (GRCm38) probably null Het
Cdcp2 A G 4: 107,106,772 (GRCm38) Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 (GRCm38) V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 (GRCm38) I39N probably damaging Het
Cep152 A C 2: 125,563,754 (GRCm38) S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 (GRCm38) I42T probably damaging Het
Cfap61 G T 2: 146,143,100 (GRCm38) V955L probably damaging Het
Cit G A 5: 115,908,691 (GRCm38) D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 (GRCm38) M328V probably benign Het
Cntn4 A T 6: 106,550,497 (GRCm38) I447L probably benign Het
Csmd3 T C 15: 47,857,934 (GRCm38) T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 (GRCm38) K9E probably damaging Het
Dsg1a A T 18: 20,333,722 (GRCm38) T550S probably benign Het
Dtnb A G 12: 3,749,505 (GRCm38) E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 (GRCm38) probably benign Het
Efl1 T A 7: 82,671,719 (GRCm38) V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 (GRCm38) Y769C probably benign Het
Fcho2 T C 13: 98,806,366 (GRCm38) Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 (GRCm38) V294A probably damaging Het
Gls A G 1: 52,199,945 (GRCm38) probably benign Het
Gm15130 A T 2: 111,135,369 (GRCm38) probably benign Het
Gm6185 A T 1: 161,213,158 (GRCm38) noncoding transcript Het
Gpr171 T A 3: 59,098,096 (GRCm38) H86L probably damaging Het
Gpr179 T C 11: 97,339,248 (GRCm38) T694A probably damaging Het
H2-Aa A T 17: 34,283,820 (GRCm38) V124E probably damaging Het
H2-M5 A G 17: 36,989,417 (GRCm38) probably benign Het
Hist1h2bl A G 13: 21,715,965 (GRCm38) M60T probably benign Het
Igf2r A T 17: 12,684,097 (GRCm38) N2355K probably damaging Het
Il9r A C 11: 32,192,654 (GRCm38) S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 (GRCm38) T313A probably benign Het
Kalrn C T 16: 34,514,019 (GRCm38) probably benign Het
Lama3 G A 18: 12,477,604 (GRCm38) V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 (GRCm38) C242* probably null Het
Lipe A G 7: 25,380,143 (GRCm38) S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 (GRCm38) T169I probably benign Het
Lrrc39 T C 3: 116,568,866 (GRCm38) probably null Het
Lrrd1 T A 5: 3,851,126 (GRCm38) L477* probably null Het
Lrriq4 A G 3: 30,660,047 (GRCm38) I515V possibly damaging Het
Magel2 A G 7: 62,381,092 (GRCm38) Y1248C unknown Het
Maml1 G T 11: 50,258,335 (GRCm38) N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 (GRCm38) H139L possibly damaging Het
Mef2d C T 3: 88,168,090 (GRCm38) P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 (GRCm38) K38E probably benign Het
Mtmr4 T C 11: 87,604,097 (GRCm38) V405A probably damaging Het
Naip5 T C 13: 100,219,696 (GRCm38) Q1137R probably benign Het
Naip5 G A 13: 100,219,687 (GRCm38) T1140M probably benign Het
Naip5 G A 13: 100,219,681 (GRCm38) S1142F probably benign Het
Nfe2l3 T C 6: 51,456,624 (GRCm38) S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 (GRCm38) I235V probably benign Het
Nyap2 T A 1: 81,241,313 (GRCm38) L318Q probably damaging Het
Nynrin G A 14: 55,872,001 (GRCm38) V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 (GRCm38) N74K probably benign Het
Olfr1461 A G 19: 13,165,124 (GRCm38) I37V probably benign Het
Olfr659 C T 7: 104,670,735 (GRCm38) P11L probably benign Het
Olfr810 T C 10: 129,791,439 (GRCm38) D50G probably damaging Het
Olfr875 T A 9: 37,773,430 (GRCm38) M257K possibly damaging Het
Oog3 A G 4: 144,159,161 (GRCm38) L289P probably damaging Het
Pax6 T C 2: 105,683,784 (GRCm38) probably benign Het
Pbrm1 G A 14: 31,110,448 (GRCm38) R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 (GRCm38) R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 (GRCm38) S747P probably benign Het
Pcnx3 A C 19: 5,687,995 (GRCm38) probably null Het
Pds5a A T 5: 65,651,289 (GRCm38) V413E probably damaging Het
Phpt1 G T 2: 25,574,320 (GRCm38) probably benign Het
Phykpl A G 11: 51,592,953 (GRCm38) E220G probably benign Het
Pias2 T C 18: 77,105,891 (GRCm38) probably null Het
Pkhd1 T A 1: 20,199,415 (GRCm38) I3302L probably damaging Het
Poli A G 18: 70,522,751 (GRCm38) L241P probably damaging Het
Ppm1h T A 10: 122,679,379 (GRCm38) I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 (GRCm38) L954P probably damaging Het
Pxk T G 14: 8,136,893 (GRCm38) M138R probably damaging Het
Rasl11b G T 5: 74,198,397 (GRCm38) D188Y probably damaging Het
Rtraf A G 14: 19,822,576 (GRCm38) F59S probably benign Het
Serpinb5 G T 1: 106,872,339 (GRCm38) L86F probably damaging Het
Setdb2 G A 14: 59,413,646 (GRCm38) T412I probably benign Het
Shank2 C A 7: 144,052,306 (GRCm38) N75K probably damaging Het
Shank3 T A 15: 89,543,115 (GRCm38) I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 (GRCm38) M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 (GRCm38) Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 (GRCm38) N495S probably damaging Het
Smc2 A G 4: 52,451,231 (GRCm38) T292A probably benign Het
Spag9 T C 11: 94,048,599 (GRCm38) probably benign Het
Tas2r113 C T 6: 132,893,782 (GRCm38) P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 (GRCm38) S530G probably benign Het
Tenm2 A G 11: 36,027,290 (GRCm38) V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 (GRCm38) R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 (GRCm38) G147V possibly damaging Het
Trim38 A T 13: 23,788,281 (GRCm38) E195V probably damaging Het
Try5 T C 6: 41,313,415 (GRCm38) Y45C probably benign Het
Umad1 A C 6: 8,457,462 (GRCm38) probably benign Het
Vmn2r105 T C 17: 20,208,691 (GRCm38) I708V probably benign Het
Zc3h12d A T 10: 7,867,947 (GRCm38) S494C probably damaging Het
Zeb2 A G 2: 44,997,768 (GRCm38) S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 (GRCm38) S1304G probably benign Het
Zfp287 G T 11: 62,714,248 (GRCm38) T611K probably damaging Het
Zfp534 G A 4: 147,674,286 (GRCm38) T642I possibly damaging Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9,493,108 (GRCm38) missense probably damaging 0.97
IGL00426:Dip2c APN 13 9,606,515 (GRCm38) missense probably damaging 1.00
IGL00503:Dip2c APN 13 9,567,898 (GRCm38) missense probably damaging 1.00
IGL00586:Dip2c APN 13 9,610,755 (GRCm38) missense probably damaging 1.00
IGL01306:Dip2c APN 13 9,575,143 (GRCm38) missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9,637,088 (GRCm38) splice site probably null
IGL01985:Dip2c APN 13 9,553,267 (GRCm38) splice site probably benign
IGL02060:Dip2c APN 13 9,622,630 (GRCm38) missense probably damaging 0.98
IGL02122:Dip2c APN 13 9,506,659 (GRCm38) missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9,606,335 (GRCm38) missense probably benign 0.03
IGL02211:Dip2c APN 13 9,610,847 (GRCm38) missense probably damaging 1.00
IGL02755:Dip2c APN 13 9,550,320 (GRCm38) critical splice donor site probably null
IGL02836:Dip2c APN 13 9,610,790 (GRCm38) missense probably damaging 0.98
IGL02935:Dip2c APN 13 9,662,146 (GRCm38) missense probably damaging 1.00
IGL03032:Dip2c APN 13 9,551,778 (GRCm38) missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9,575,143 (GRCm38) missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9,646,982 (GRCm38) missense probably damaging 1.00
R0009:Dip2c UTSW 13 9,621,903 (GRCm38) missense probably damaging 1.00
R0268:Dip2c UTSW 13 9,637,150 (GRCm38) missense probably damaging 1.00
R0271:Dip2c UTSW 13 9,615,775 (GRCm38) missense probably damaging 1.00
R0306:Dip2c UTSW 13 9,604,599 (GRCm38) missense probably benign 0.09
R0415:Dip2c UTSW 13 9,568,289 (GRCm38) splice site probably benign
R0519:Dip2c UTSW 13 9,563,208 (GRCm38) missense probably damaging 1.00
R0557:Dip2c UTSW 13 9,553,459 (GRCm38) missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9,568,663 (GRCm38) missense probably benign 0.43
R0973:Dip2c UTSW 13 9,576,908 (GRCm38) missense probably damaging 0.99
R0973:Dip2c UTSW 13 9,576,908 (GRCm38) missense probably damaging 0.99
R0974:Dip2c UTSW 13 9,576,908 (GRCm38) missense probably damaging 0.99
R1101:Dip2c UTSW 13 9,634,744 (GRCm38) missense probably damaging 1.00
R1171:Dip2c UTSW 13 9,493,126 (GRCm38) missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9,553,264 (GRCm38) splice site probably null
R1403:Dip2c UTSW 13 9,553,264 (GRCm38) splice site probably null
R1432:Dip2c UTSW 13 9,553,304 (GRCm38) missense probably damaging 0.99
R1481:Dip2c UTSW 13 9,551,866 (GRCm38) critical splice donor site probably null
R1588:Dip2c UTSW 13 9,665,864 (GRCm38) missense probably damaging 1.00
R1721:Dip2c UTSW 13 9,659,368 (GRCm38) missense probably damaging 1.00
R1726:Dip2c UTSW 13 9,575,428 (GRCm38) missense probably damaging 1.00
R1867:Dip2c UTSW 13 9,621,949 (GRCm38) missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9,533,350 (GRCm38) missense probably benign 0.00
R2013:Dip2c UTSW 13 9,567,846 (GRCm38) nonsense probably null
R2022:Dip2c UTSW 13 9,551,800 (GRCm38) missense probably damaging 1.00
R2517:Dip2c UTSW 13 9,609,005 (GRCm38) missense probably damaging 1.00
R3746:Dip2c UTSW 13 9,601,473 (GRCm38) missense probably damaging 1.00
R3794:Dip2c UTSW 13 9,604,561 (GRCm38) missense probably damaging 0.99
R3884:Dip2c UTSW 13 9,551,858 (GRCm38) missense probably damaging 1.00
R4019:Dip2c UTSW 13 9,614,365 (GRCm38) missense probably damaging 0.99
R4110:Dip2c UTSW 13 9,637,101 (GRCm38) missense probably damaging 1.00
R4111:Dip2c UTSW 13 9,637,101 (GRCm38) missense probably damaging 1.00
R4113:Dip2c UTSW 13 9,637,101 (GRCm38) missense probably damaging 1.00
R4256:Dip2c UTSW 13 9,609,056 (GRCm38) missense probably damaging 1.00
R4300:Dip2c UTSW 13 9,610,711 (GRCm38) missense probably damaging 1.00
R4494:Dip2c UTSW 13 9,571,062 (GRCm38) missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9,533,339 (GRCm38) missense probably damaging 0.98
R4812:Dip2c UTSW 13 9,637,130 (GRCm38) nonsense probably null
R4814:Dip2c UTSW 13 9,536,860 (GRCm38) missense probably benign 0.07
R4828:Dip2c UTSW 13 9,560,679 (GRCm38) missense probably damaging 1.00
R4915:Dip2c UTSW 13 9,621,869 (GRCm38) splice site probably null
R4917:Dip2c UTSW 13 9,621,869 (GRCm38) splice site probably null
R4932:Dip2c UTSW 13 9,623,972 (GRCm38) missense probably damaging 0.99
R4993:Dip2c UTSW 13 9,575,223 (GRCm38) nonsense probably null
R5043:Dip2c UTSW 13 9,551,827 (GRCm38) missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9,622,653 (GRCm38) missense probably damaging 1.00
R5744:Dip2c UTSW 13 9,568,405 (GRCm38) missense probably damaging 1.00
R5840:Dip2c UTSW 13 9,506,676 (GRCm38) missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9,623,766 (GRCm38) missense probably damaging 1.00
R6160:Dip2c UTSW 13 9,533,254 (GRCm38) missense probably benign 0.01
R6161:Dip2c UTSW 13 9,647,007 (GRCm38) missense probably damaging 1.00
R6477:Dip2c UTSW 13 9,623,760 (GRCm38) missense probably damaging 1.00
R6522:Dip2c UTSW 13 9,575,228 (GRCm38) critical splice donor site probably null
R6603:Dip2c UTSW 13 9,654,588 (GRCm38) splice site probably null
R6658:Dip2c UTSW 13 9,493,177 (GRCm38) critical splice donor site probably null
R6672:Dip2c UTSW 13 9,567,830 (GRCm38) critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9,621,913 (GRCm38) missense probably damaging 1.00
R6991:Dip2c UTSW 13 9,634,832 (GRCm38) missense probably damaging 1.00
R6991:Dip2c UTSW 13 9,551,860 (GRCm38) nonsense probably null
R7018:Dip2c UTSW 13 9,659,278 (GRCm38) missense probably damaging 1.00
R7053:Dip2c UTSW 13 9,610,704 (GRCm38) missense probably damaging 1.00
R7102:Dip2c UTSW 13 9,604,536 (GRCm38) missense probably benign 0.01
R7171:Dip2c UTSW 13 9,506,648 (GRCm38) missense probably benign 0.34
R7371:Dip2c UTSW 13 9,592,749 (GRCm38) missense probably benign 0.02
R7395:Dip2c UTSW 13 9,614,377 (GRCm38) missense probably damaging 1.00
R7489:Dip2c UTSW 13 9,533,312 (GRCm38) missense probably damaging 0.99
R7575:Dip2c UTSW 13 9,628,012 (GRCm38) missense probably damaging 0.97
R7642:Dip2c UTSW 13 9,622,705 (GRCm38) critical splice donor site probably null
R7687:Dip2c UTSW 13 9,604,581 (GRCm38) missense probably benign 0.00
R7699:Dip2c UTSW 13 9,659,311 (GRCm38) missense probably benign 0.00
R7700:Dip2c UTSW 13 9,659,311 (GRCm38) missense probably benign 0.00
R7715:Dip2c UTSW 13 9,614,391 (GRCm38) missense probably damaging 1.00
R7842:Dip2c UTSW 13 9,606,533 (GRCm38) critical splice donor site probably null
R7845:Dip2c UTSW 13 9,609,044 (GRCm38) missense probably damaging 1.00
R8354:Dip2c UTSW 13 9,621,882 (GRCm38) missense probably benign 0.05
R8685:Dip2c UTSW 13 9,637,125 (GRCm38) missense probably benign 0.01
R8779:Dip2c UTSW 13 9,610,809 (GRCm38) missense probably damaging 0.98
R8786:Dip2c UTSW 13 9,615,794 (GRCm38) missense probably damaging 0.99
R8815:Dip2c UTSW 13 9,623,798 (GRCm38) nonsense probably null
R8833:Dip2c UTSW 13 9,575,483 (GRCm38) critical splice donor site probably null
R8868:Dip2c UTSW 13 9,575,467 (GRCm38) missense possibly damaging 0.73
R8873:Dip2c UTSW 13 9,575,146 (GRCm38) missense probably benign 0.03
R8887:Dip2c UTSW 13 9,623,953 (GRCm38) splice site probably benign
R8923:Dip2c UTSW 13 9,623,865 (GRCm38) missense probably damaging 1.00
R9112:Dip2c UTSW 13 9,610,730 (GRCm38) missense probably damaging 1.00
R9424:Dip2c UTSW 13 9,659,395 (GRCm38) missense probably damaging 1.00
R9474:Dip2c UTSW 13 9,494,927 (GRCm38) missense unknown
R9527:Dip2c UTSW 13 9,494,839 (GRCm38) missense unknown
R9593:Dip2c UTSW 13 9,654,647 (GRCm38) missense possibly damaging 0.89
R9615:Dip2c UTSW 13 9,575,155 (GRCm38) missense probably benign 0.03
R9801:Dip2c UTSW 13 9,576,900 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCATCTTCTTGTCCTCAAAAG -3'
(R):5'- GAAGTTATCGTGTGTCACTGCC -3'

Sequencing Primer
(F):5'- CAAAAGCTCCTCTTGTGTTAGTCAAC -3'
(R):5'- ACTGCCAGGCTGTGTGTAGC -3'
Posted On 2016-02-04