Incidental Mutation 'R4816:Trim38'
ID 369835
Institutional Source Beutler Lab
Gene Symbol Trim38
Ensembl Gene ENSMUSG00000064140
Gene Name tripartite motif-containing 38
Synonyms LOC214158
MMRRC Submission 042434-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R4816 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 23769913-23791528 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 23788281 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 195 (E195V)
Ref Sequence ENSEMBL: ENSMUSP00000153240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074067] [ENSMUST00000223911] [ENSMUST00000226039]
AlphaFold Q5SZ99
Predicted Effect probably damaging
Transcript: ENSMUST00000074067
AA Change: E195V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073709
Gene: ENSMUSG00000064140
AA Change: E195V

DomainStartEndE-ValueType
RING 16 61 8.95e-7 SMART
BBOX 90 131 4.34e-5 SMART
coiled coil region 202 249 N/A INTRINSIC
PRY 293 347 2.31e-9 SMART
SPRY 348 469 6.71e-21 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223911
AA Change: E195V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226039
AA Change: E195V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.8203 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) family. The encoded protein contains a RING-type zinc finger, B box-type zinc finger and SPRY domain. The function of this protein has not been identified. A pseudogene of this gene is located on the long arm of chromosome 4. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased poly(I:C) and LPS-induced IFN-beta, TNFalpha and IL6 with increased induced mortality induced by poly(I:C), LPS or S. typhimurium infection, [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 probably null Het
Abcc8 C A 7: 46,104,707 A1562S probably benign Het
Adam30 C A 3: 98,162,745 D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 A196V probably benign Het
Baiap3 T A 17: 25,247,295 probably benign Het
Bicra T C 7: 15,988,906 T229A possibly damaging Het
C1qbp A G 11: 70,982,364 probably benign Het
C2cd3 C A 7: 100,391,019 T265K probably benign Het
Cacna1s T A 1: 136,115,269 I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdcp2 A G 4: 107,106,772 Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 I39N probably damaging Het
Cep152 A C 2: 125,563,754 S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 I42T probably damaging Het
Cfap61 G T 2: 146,143,100 V955L probably damaging Het
Cit G A 5: 115,908,691 D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Cntn4 A T 6: 106,550,497 I447L probably benign Het
Csmd3 T C 15: 47,857,934 T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 K9E probably damaging Het
Dip2c T A 13: 9,575,150 M560K probably benign Het
Dsg1a A T 18: 20,333,722 T550S probably benign Het
Dtnb A G 12: 3,749,505 E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 probably benign Het
Efl1 T A 7: 82,671,719 V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 Y769C probably benign Het
Fcho2 T C 13: 98,806,366 Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 V294A probably damaging Het
Gls A G 1: 52,199,945 probably benign Het
Gm15130 A T 2: 111,135,369 probably benign Het
Gm6185 A T 1: 161,213,158 noncoding transcript Het
Gpr171 T A 3: 59,098,096 H86L probably damaging Het
Gpr179 T C 11: 97,339,248 T694A probably damaging Het
H2-Aa A T 17: 34,283,820 V124E probably damaging Het
H2-M5 A G 17: 36,989,417 probably benign Het
Hist1h2bl A G 13: 21,715,965 M60T probably benign Het
Igf2r A T 17: 12,684,097 N2355K probably damaging Het
Il9r A C 11: 32,192,654 S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 T313A probably benign Het
Kalrn C T 16: 34,514,019 probably benign Het
Lama3 G A 18: 12,477,604 V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 C242* probably null Het
Lipe A G 7: 25,380,143 S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 T169I probably benign Het
Lrrc39 T C 3: 116,568,866 probably null Het
Lrrd1 T A 5: 3,851,126 L477* probably null Het
Lrriq4 A G 3: 30,660,047 I515V possibly damaging Het
Magel2 A G 7: 62,381,092 Y1248C unknown Het
Maml1 G T 11: 50,258,335 N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 H139L possibly damaging Het
Mef2d C T 3: 88,168,090 P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 K38E probably benign Het
Mtmr4 T C 11: 87,604,097 V405A probably damaging Het
Naip5 G A 13: 100,219,681 S1142F probably benign Het
Naip5 G A 13: 100,219,687 T1140M probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nfe2l3 T C 6: 51,456,624 S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 I235V probably benign Het
Nyap2 T A 1: 81,241,313 L318Q probably damaging Het
Nynrin G A 14: 55,872,001 V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 N74K probably benign Het
Olfr1461 A G 19: 13,165,124 I37V probably benign Het
Olfr659 C T 7: 104,670,735 P11L probably benign Het
Olfr810 T C 10: 129,791,439 D50G probably damaging Het
Olfr875 T A 9: 37,773,430 M257K possibly damaging Het
Oog3 A G 4: 144,159,161 L289P probably damaging Het
Pax6 T C 2: 105,683,784 probably benign Het
Pbrm1 G A 14: 31,110,448 R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 S747P probably benign Het
Pcnx3 A C 19: 5,687,995 probably null Het
Pds5a A T 5: 65,651,289 V413E probably damaging Het
Phpt1 G T 2: 25,574,320 probably benign Het
Phykpl A G 11: 51,592,953 E220G probably benign Het
Pias2 T C 18: 77,105,891 probably null Het
Pkhd1 T A 1: 20,199,415 I3302L probably damaging Het
Poli A G 18: 70,522,751 L241P probably damaging Het
Ppm1h T A 10: 122,679,379 I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 L954P probably damaging Het
Pxk T G 14: 8,136,893 M138R probably damaging Het
Rasl11b G T 5: 74,198,397 D188Y probably damaging Het
Rtraf A G 14: 19,822,576 F59S probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setdb2 G A 14: 59,413,646 T412I probably benign Het
Shank2 C A 7: 144,052,306 N75K probably damaging Het
Shank3 T A 15: 89,543,115 I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 N495S probably damaging Het
Smc2 A G 4: 52,451,231 T292A probably benign Het
Spag9 T C 11: 94,048,599 probably benign Het
Tas2r113 C T 6: 132,893,782 P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 S530G probably benign Het
Tenm2 A G 11: 36,027,290 V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 G147V possibly damaging Het
Try5 T C 6: 41,313,415 Y45C probably benign Het
Umad1 A C 6: 8,457,462 probably benign Het
Vmn2r105 T C 17: 20,208,691 I708V probably benign Het
Zc3h12d A T 10: 7,867,947 S494C probably damaging Het
Zeb2 A G 2: 44,997,768 S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 S1304G probably benign Het
Zfp287 G T 11: 62,714,248 T611K probably damaging Het
Zfp534 G A 4: 147,674,286 T642I possibly damaging Het
Other mutations in Trim38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Trim38 APN 13 23791032 missense possibly damaging 0.91
IGL01592:Trim38 APN 13 23791427 missense possibly damaging 0.85
IGL02339:Trim38 APN 13 23788230 missense probably damaging 1.00
IGL03062:Trim38 APN 13 23782963 missense probably damaging 1.00
IGL03278:Trim38 APN 13 23790996 missense possibly damaging 0.65
R0630:Trim38 UTSW 13 23791132 nonsense probably null
R1263:Trim38 UTSW 13 23791134 missense probably damaging 1.00
R1560:Trim38 UTSW 13 23782702 missense probably benign 0.02
R1978:Trim38 UTSW 13 23791098 missense probably damaging 1.00
R4407:Trim38 UTSW 13 23791491 missense probably benign 0.04
R4462:Trim38 UTSW 13 23791452 missense probably null 1.00
R4649:Trim38 UTSW 13 23782969 missense probably damaging 1.00
R4651:Trim38 UTSW 13 23782969 missense probably damaging 1.00
R4653:Trim38 UTSW 13 23782969 missense probably damaging 1.00
R4970:Trim38 UTSW 13 23791329 missense probably damaging 0.98
R5946:Trim38 UTSW 13 23782734 missense probably benign 0.04
R6538:Trim38 UTSW 13 23785949 missense probably damaging 0.97
R6974:Trim38 UTSW 13 23789519 missense probably benign 0.05
R7227:Trim38 UTSW 13 23785963 missense possibly damaging 0.88
R7319:Trim38 UTSW 13 23791401 missense probably damaging 1.00
R7425:Trim38 UTSW 13 23788382 missense probably benign 0.02
R8243:Trim38 UTSW 13 23791395 missense probably damaging 1.00
R8965:Trim38 UTSW 13 23791023 missense possibly damaging 0.65
R9354:Trim38 UTSW 13 23785892 missense probably benign 0.09
R9573:Trim38 UTSW 13 23782705 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAGCTTACATCAGTGTAGCTG -3'
(R):5'- ACAGCCTCACCTGTAGCAATTTC -3'

Sequencing Primer
(F):5'- TAGCAGGATGTCATCAAGCTTCC -3'
(R):5'- ACCTGTAGCAATTTCTGGGC -3'
Posted On 2016-02-04