Incidental Mutation 'R4816:Pbrm1'
ID369843
Institutional Source Beutler Lab
Gene Symbol Pbrm1
Ensembl Gene ENSMUSG00000042323
Gene Namepolybromo 1
SynonymsBAF180, Pb1, 2610016F04Rik, 2310032M22Rik
MMRRC Submission 042434-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4816 (G1)
Quality Score160
Status Validated
Chromosome14
Chromosomal Location31019138-31121592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31110448 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 1441 (R1441K)
Ref Sequence ENSEMBL: ENSMUSP00000087682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022471] [ENSMUST00000022474] [ENSMUST00000052239] [ENSMUST00000064032] [ENSMUST00000090214] [ENSMUST00000112092] [ENSMUST00000112094] [ENSMUST00000112095] [ENSMUST00000112098] [ENSMUST00000123678] [ENSMUST00000136237] [ENSMUST00000156628] [ENSMUST00000203261]
Predicted Effect probably benign
Transcript: ENSMUST00000022471
SMART Domains Protein: ENSMUSP00000022471
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1450 8.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022474
SMART Domains Protein: ENSMUSP00000022474
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1465 8.91e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000052239
SMART Domains Protein: ENSMUSP00000060476
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1049 8.64e-22 SMART
low complexity region 1058 1072 N/A INTRINSIC
BAH 1131 1247 3.02e-35 SMART
low complexity region 1293 1310 N/A INTRINSIC
HMG 1326 1396 2.87e-13 SMART
low complexity region 1405 1430 N/A INTRINSIC
low complexity region 1449 1477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064032
SMART Domains Protein: ENSMUSP00000067418
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090214
AA Change: R1441K

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000087682
Gene: ENSMUSG00000042323
AA Change: R1441K

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 1.62e-21 SMART
low complexity region 1464 1475 N/A INTRINSIC
low complexity region 1485 1500 N/A INTRINSIC
low complexity region 1512 1537 N/A INTRINSIC
low complexity region 1556 1584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112092
AA Change: R1456K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000107721
Gene: ENSMUSG00000042323
AA Change: R1456K

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1519 1547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112094
SMART Domains Protein: ENSMUSP00000107723
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 322 338 N/A INTRINSIC
BROMO 347 457 1.57e-32 SMART
BROMO 484 595 6.07e-39 SMART
BROMO 619 733 3.01e-43 SMART
BROMO 743 849 2.53e-18 SMART
coiled coil region 875 902 N/A INTRINSIC
BAH 924 1042 1.33e-45 SMART
low complexity region 1051 1065 N/A INTRINSIC
BAH 1124 1240 3.02e-35 SMART
low complexity region 1286 1306 N/A INTRINSIC
HMG 1346 1416 2.87e-13 SMART
low complexity region 1425 1450 N/A INTRINSIC
low complexity region 1469 1497 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112095
SMART Domains Protein: ENSMUSP00000107724
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
coiled coil region 907 934 N/A INTRINSIC
BAH 956 1074 1.33e-45 SMART
low complexity region 1083 1097 N/A INTRINSIC
BAH 1156 1272 3.02e-35 SMART
low complexity region 1318 1338 N/A INTRINSIC
HMG 1378 1448 2.87e-13 SMART
low complexity region 1457 1482 N/A INTRINSIC
low complexity region 1501 1529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112098
AA Change: R1456K

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000107727
Gene: ENSMUSG00000042323
AA Change: R1456K

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 531 642 6.07e-39 SMART
BROMO 666 780 3.01e-43 SMART
BROMO 790 896 2.53e-18 SMART
coiled coil region 922 949 N/A INTRINSIC
BAH 971 1089 1.33e-45 SMART
low complexity region 1098 1112 N/A INTRINSIC
BAH 1171 1287 3.02e-35 SMART
low complexity region 1333 1353 N/A INTRINSIC
HMG 1393 1463 1.62e-21 SMART
low complexity region 1479 1490 N/A INTRINSIC
low complexity region 1500 1515 N/A INTRINSIC
low complexity region 1527 1552 N/A INTRINSIC
low complexity region 1571 1599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123678
SMART Domains Protein: ENSMUSP00000120549
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 856 2.3e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136237
SMART Domains Protein: ENSMUSP00000119722
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 859 7.08e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156628
SMART Domains Protein: ENSMUSP00000123546
Gene: ENSMUSG00000042323

DomainStartEndE-ValueType
BROMO 43 153 4.97e-35 SMART
BROMO 175 289 5.84e-41 SMART
low complexity region 354 370 N/A INTRINSIC
BROMO 379 489 1.57e-32 SMART
BROMO 516 627 6.07e-39 SMART
BROMO 651 765 3.01e-43 SMART
BROMO 775 881 2.53e-18 SMART
low complexity region 903 933 N/A INTRINSIC
BAH 955 1073 1.33e-45 SMART
low complexity region 1082 1096 N/A INTRINSIC
BAH 1155 1271 3.02e-35 SMART
low complexity region 1317 1337 N/A INTRINSIC
HMG 1377 1447 2.87e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203261
SMART Domains Protein: ENSMUSP00000145018
Gene: ENSMUSG00000058351

DomainStartEndE-ValueType
Pfam:UPF0640 2 68 9.1e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a subunit of ATP-dependent chromatin-remodeling complexes. The encoded protein has been identified as in integral component of complexes necessary for ligand-dependent transcriptional activation by nuclear hormone receptors. Mutations at this locus have been associated with primary clear cell renal cell carcinoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality with hypoplastic cardiac ventricular chambers and malformation of the placenta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 probably null Het
Abcc8 C A 7: 46,104,707 A1562S probably benign Het
Adam30 C A 3: 98,162,745 D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 A196V probably benign Het
Baiap3 T A 17: 25,247,295 probably benign Het
Bicra T C 7: 15,988,906 T229A possibly damaging Het
C1qbp A G 11: 70,982,364 probably benign Het
C2cd3 C A 7: 100,391,019 T265K probably benign Het
Cacna1s T A 1: 136,115,269 I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdcp2 A G 4: 107,106,772 Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 I39N probably damaging Het
Cep152 A C 2: 125,563,754 S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 I42T probably damaging Het
Cfap61 G T 2: 146,143,100 V955L probably damaging Het
Cit G A 5: 115,908,691 D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Cntn4 A T 6: 106,550,497 I447L probably benign Het
Csmd3 T C 15: 47,857,934 T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 K9E probably damaging Het
Dip2c T A 13: 9,575,150 M560K probably benign Het
Dsg1a A T 18: 20,333,722 T550S probably benign Het
Dtnb A G 12: 3,749,505 E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 probably benign Het
Efl1 T A 7: 82,671,719 V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 Y769C probably benign Het
Fcho2 T C 13: 98,806,366 Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 V294A probably damaging Het
Gls A G 1: 52,199,945 probably benign Het
Gm15130 A T 2: 111,135,369 probably benign Het
Gm6185 A T 1: 161,213,158 noncoding transcript Het
Gpr171 T A 3: 59,098,096 H86L probably damaging Het
Gpr179 T C 11: 97,339,248 T694A probably damaging Het
H2-Aa A T 17: 34,283,820 V124E probably damaging Het
H2-M5 A G 17: 36,989,417 probably benign Het
Hist1h2bl A G 13: 21,715,965 M60T probably benign Het
Igf2r A T 17: 12,684,097 N2355K probably damaging Het
Il9r A C 11: 32,192,654 S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 T313A probably benign Het
Kalrn C T 16: 34,514,019 probably benign Het
Lama3 G A 18: 12,477,604 V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 C242* probably null Het
Lipe A G 7: 25,380,143 S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 T169I probably benign Het
Lrrc39 T C 3: 116,568,866 probably null Het
Lrrd1 T A 5: 3,851,126 L477* probably null Het
Lrriq4 A G 3: 30,660,047 I515V possibly damaging Het
Magel2 A G 7: 62,381,092 Y1248C unknown Het
Maml1 G T 11: 50,258,335 N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 H139L possibly damaging Het
Mef2d C T 3: 88,168,090 P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 K38E probably benign Het
Mtmr4 T C 11: 87,604,097 V405A probably damaging Het
Naip5 G A 13: 100,219,681 S1142F probably benign Het
Naip5 G A 13: 100,219,687 T1140M probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nfe2l3 T C 6: 51,456,624 S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 I235V probably benign Het
Nyap2 T A 1: 81,241,313 L318Q probably damaging Het
Nynrin G A 14: 55,872,001 V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 N74K probably benign Het
Olfr1461 A G 19: 13,165,124 I37V probably benign Het
Olfr659 C T 7: 104,670,735 P11L probably benign Het
Olfr810 T C 10: 129,791,439 D50G probably damaging Het
Olfr875 T A 9: 37,773,430 M257K possibly damaging Het
Oog3 A G 4: 144,159,161 L289P probably damaging Het
Pax6 T C 2: 105,683,784 probably benign Het
Pcdha9 C T 18: 36,999,458 R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 S747P probably benign Het
Pcnx3 A C 19: 5,687,995 probably null Het
Pds5a A T 5: 65,651,289 V413E probably damaging Het
Phpt1 G T 2: 25,574,320 probably benign Het
Phykpl A G 11: 51,592,953 E220G probably benign Het
Pias2 T C 18: 77,105,891 probably null Het
Pkhd1 T A 1: 20,199,415 I3302L probably damaging Het
Poli A G 18: 70,522,751 L241P probably damaging Het
Ppm1h T A 10: 122,679,379 I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 L954P probably damaging Het
Pxk T G 14: 8,136,893 M138R probably damaging Het
Rasl11b G T 5: 74,198,397 D188Y probably damaging Het
Rtraf A G 14: 19,822,576 F59S probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setdb2 G A 14: 59,413,646 T412I probably benign Het
Shank2 C A 7: 144,052,306 N75K probably damaging Het
Shank3 T A 15: 89,543,115 I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 N495S probably damaging Het
Smc2 A G 4: 52,451,231 T292A probably benign Het
Spag9 T C 11: 94,048,599 probably benign Het
Tas2r113 C T 6: 132,893,782 P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 S530G probably benign Het
Tenm2 A G 11: 36,027,290 V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 G147V possibly damaging Het
Trim38 A T 13: 23,788,281 E195V probably damaging Het
Try5 T C 6: 41,313,415 Y45C probably benign Het
Umad1 A C 6: 8,457,462 probably benign Het
Vmn2r105 T C 17: 20,208,691 I708V probably benign Het
Zc3h12d A T 10: 7,867,947 S494C probably damaging Het
Zeb2 A G 2: 44,997,768 S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 S1304G probably benign Het
Zfp287 G T 11: 62,714,248 T611K probably damaging Het
Zfp534 G A 4: 147,674,286 T642I possibly damaging Het
Other mutations in Pbrm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00598:Pbrm1 APN 14 31030927 missense probably damaging 1.00
IGL00648:Pbrm1 APN 14 31052283 missense probably damaging 1.00
IGL00654:Pbrm1 APN 14 31032404 splice site probably benign
IGL00674:Pbrm1 APN 14 31118776 missense probably damaging 1.00
IGL00701:Pbrm1 APN 14 31052248 missense probably damaging 1.00
IGL00850:Pbrm1 APN 14 31087619 missense probably damaging 1.00
IGL01024:Pbrm1 APN 14 31052260 missense probably damaging 1.00
IGL01924:Pbrm1 APN 14 31082604 missense probably damaging 1.00
IGL02122:Pbrm1 APN 14 31089616 missense probably damaging 0.97
IGL02390:Pbrm1 APN 14 31032510 missense probably benign 0.00
IGL02675:Pbrm1 APN 14 31106287 missense possibly damaging 0.85
IGL02936:Pbrm1 APN 14 31061513 missense probably damaging 1.00
IGL02938:Pbrm1 APN 14 31067804 missense probably damaging 1.00
IGL02997:Pbrm1 APN 14 31061551 missense probably damaging 1.00
IGL03246:Pbrm1 APN 14 31110549 missense probably benign 0.00
IGL03290:Pbrm1 APN 14 31107284 missense probably damaging 1.00
IGL03372:Pbrm1 APN 14 31085019 missense probably benign 0.04
IGL03386:Pbrm1 APN 14 31050092 missense probably damaging 1.00
PIT4520001:Pbrm1 UTSW 14 31067861 missense probably damaging 0.99
R0502:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R0552:Pbrm1 UTSW 14 31035959 missense probably damaging 1.00
R0558:Pbrm1 UTSW 14 31085059 splice site probably null
R0561:Pbrm1 UTSW 14 31035991 missense probably benign
R0591:Pbrm1 UTSW 14 31046430 splice site probably benign
R0835:Pbrm1 UTSW 14 31067579 missense probably damaging 1.00
R1167:Pbrm1 UTSW 14 31050142 missense probably damaging 1.00
R1209:Pbrm1 UTSW 14 31118852 missense probably damaging 1.00
R1259:Pbrm1 UTSW 14 31074814 missense probably damaging 1.00
R1321:Pbrm1 UTSW 14 31067502 missense probably damaging 1.00
R1622:Pbrm1 UTSW 14 31032548 missense probably benign 0.07
R1843:Pbrm1 UTSW 14 31038957 missense probably damaging 1.00
R1870:Pbrm1 UTSW 14 31106175 missense probably damaging 0.99
R2202:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2203:Pbrm1 UTSW 14 31032449 missense possibly damaging 0.76
R2247:Pbrm1 UTSW 14 31074893 missense probably damaging 1.00
R3237:Pbrm1 UTSW 14 31032475 missense probably damaging 1.00
R4091:Pbrm1 UTSW 14 31036003 missense probably benign 0.00
R4280:Pbrm1 UTSW 14 31107312 critical splice donor site probably null
R4379:Pbrm1 UTSW 14 31067706 missense probably damaging 1.00
R4381:Pbrm1 UTSW 14 31025556 missense probably benign 0.02
R4939:Pbrm1 UTSW 14 31061623 missense probably damaging 1.00
R4945:Pbrm1 UTSW 14 31052216 missense probably damaging 0.97
R4958:Pbrm1 UTSW 14 31074827 missense probably damaging 1.00
R5095:Pbrm1 UTSW 14 31032530 missense probably benign 0.00
R5276:Pbrm1 UTSW 14 31106184 missense probably damaging 0.99
R5387:Pbrm1 UTSW 14 31082610 missense probably damaging 1.00
R5434:Pbrm1 UTSW 14 31085011 missense probably damaging 0.96
R5476:Pbrm1 UTSW 14 31032519 missense probably benign 0.00
R5522:Pbrm1 UTSW 14 31089563 missense probably damaging 1.00
R5548:Pbrm1 UTSW 14 31105424 missense probably damaging 1.00
R5605:Pbrm1 UTSW 14 31035992 missense probably benign 0.20
R6089:Pbrm1 UTSW 14 31087585 missense probably damaging 0.99
R6159:Pbrm1 UTSW 14 31052283 missense possibly damaging 0.95
R6224:Pbrm1 UTSW 14 31050111 missense probably benign 0.19
R6335:Pbrm1 UTSW 14 31084095 missense probably damaging 1.00
R6499:Pbrm1 UTSW 14 31061509 missense probably damaging 0.99
R6823:Pbrm1 UTSW 14 31084790 missense probably damaging 1.00
R7002:Pbrm1 UTSW 14 31064820 missense probably benign 0.36
R7021:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
R7216:Pbrm1 UTSW 14 31045422 missense possibly damaging 0.93
R7588:Pbrm1 UTSW 14 31084943 missense probably damaging 0.99
R7828:Pbrm1 UTSW 14 31030891 missense probably damaging 1.00
R8035:Pbrm1 UTSW 14 31084152 missense probably damaging 1.00
R8188:Pbrm1 UTSW 14 31067816 missense probably damaging 0.98
R8417:Pbrm1 UTSW 14 31027462 missense possibly damaging 0.92
R8517:Pbrm1 UTSW 14 31067782 missense probably benign 0.00
Z1088:Pbrm1 UTSW 14 31110454 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GACTCCTGTGTTGAGACTAGTC -3'
(R):5'- TACAGACTGTGGCCTACTCC -3'

Sequencing Primer
(F):5'- CTGTGTTGAGACTAGTCATCTACCG -3'
(R):5'- AGACTGTGGCCTACTCCTTTTGG -3'
Posted On2016-02-04