Incidental Mutation 'R4816:Tm9sf1'
ID 369845
Institutional Source Beutler Lab
Gene Symbol Tm9sf1
Ensembl Gene ENSMUSG00000002320
Gene Name transmembrane 9 superfamily member 1
Synonyms 1200014D02Rik, MP70
MMRRC Submission 042434-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.169) question?
Stock # R4816 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 55635965-55643806 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55641149 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 262 (R262Q)
Ref Sequence ENSEMBL: ENSMUSP00000118427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002391] [ENSMUST00000120041] [ENSMUST00000121791] [ENSMUST00000121937] [ENSMUST00000122358] [ENSMUST00000132338] [ENSMUST00000133707] [ENSMUST00000138085] [ENSMUST00000149726]
AlphaFold Q9DBU0
Predicted Effect possibly damaging
Transcript: ENSMUST00000002391
AA Change: R262Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000002391
Gene: ENSMUSG00000002320
AA Change: R262Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120041
AA Change: R262Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112893
Gene: ENSMUSG00000002320
AA Change: R262Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121791
AA Change: R262Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112764
Gene: ENSMUSG00000002320
AA Change: R262Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 564 1.3e-187 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121937
AA Change: R262Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113143
Gene: ENSMUSG00000002320
AA Change: R262Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 547 9e-169 PFAM
transmembrane domain 550 572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122358
AA Change: R262Q

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113782
Gene: ENSMUSG00000002320
AA Change: R262Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 58 563 2.3e-164 PFAM
transmembrane domain 569 591 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127473
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130167
Predicted Effect possibly damaging
Transcript: ENSMUST00000132338
AA Change: R262Q

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118427
Gene: ENSMUSG00000002320
AA Change: R262Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 477 9.2e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133707
SMART Domains Protein: ENSMUSP00000123471
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 118 1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138085
SMART Domains Protein: ENSMUSP00000119435
Gene: ENSMUSG00000002320

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 172 2.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146588
Predicted Effect possibly damaging
Transcript: ENSMUST00000149726
AA Change: R262Q

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115403
Gene: ENSMUSG00000002320
AA Change: R262Q

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:EMP70 57 390 1.7e-103 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228007
Meta Mutation Damage Score 0.6647 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 (GRCm38) I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 (GRCm38) probably null Het
Abcc8 C A 7: 46,104,707 (GRCm38) A1562S probably benign Het
Adam30 C A 3: 98,162,745 (GRCm38) D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 (GRCm38) T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 (GRCm38) A196V probably benign Het
Baiap3 T A 17: 25,247,295 (GRCm38) probably benign Het
Bicra T C 7: 15,988,906 (GRCm38) T229A possibly damaging Het
C1qbp A G 11: 70,982,364 (GRCm38) probably benign Het
C2cd3 C A 7: 100,391,019 (GRCm38) T265K probably benign Het
Cacna1s T A 1: 136,115,269 (GRCm38) I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 (GRCm38) probably null Het
Cdcp2 A G 4: 107,106,772 (GRCm38) Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 (GRCm38) V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 (GRCm38) I39N probably damaging Het
Cep152 A C 2: 125,563,754 (GRCm38) S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 (GRCm38) I42T probably damaging Het
Cfap61 G T 2: 146,143,100 (GRCm38) V955L probably damaging Het
Cit G A 5: 115,908,691 (GRCm38) D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 (GRCm38) M328V probably benign Het
Cntn4 A T 6: 106,550,497 (GRCm38) I447L probably benign Het
Csmd3 T C 15: 47,857,934 (GRCm38) T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 (GRCm38) K9E probably damaging Het
Dip2c T A 13: 9,575,150 (GRCm38) M560K probably benign Het
Dsg1a A T 18: 20,333,722 (GRCm38) T550S probably benign Het
Dtnb A G 12: 3,749,505 (GRCm38) E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 (GRCm38) probably benign Het
Efl1 T A 7: 82,671,719 (GRCm38) V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 (GRCm38) Y769C probably benign Het
Fcho2 T C 13: 98,806,366 (GRCm38) Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 (GRCm38) V294A probably damaging Het
Gls A G 1: 52,199,945 (GRCm38) probably benign Het
Gm15130 A T 2: 111,135,369 (GRCm38) probably benign Het
Gm6185 A T 1: 161,213,158 (GRCm38) noncoding transcript Het
Gpr171 T A 3: 59,098,096 (GRCm38) H86L probably damaging Het
Gpr179 T C 11: 97,339,248 (GRCm38) T694A probably damaging Het
H2-Aa A T 17: 34,283,820 (GRCm38) V124E probably damaging Het
H2-M5 A G 17: 36,989,417 (GRCm38) probably benign Het
Hist1h2bl A G 13: 21,715,965 (GRCm38) M60T probably benign Het
Igf2r A T 17: 12,684,097 (GRCm38) N2355K probably damaging Het
Il9r A C 11: 32,192,654 (GRCm38) S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 (GRCm38) T313A probably benign Het
Kalrn C T 16: 34,514,019 (GRCm38) probably benign Het
Lama3 G A 18: 12,477,604 (GRCm38) V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 (GRCm38) C242* probably null Het
Lipe A G 7: 25,380,143 (GRCm38) S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 (GRCm38) T169I probably benign Het
Lrrc39 T C 3: 116,568,866 (GRCm38) probably null Het
Lrrd1 T A 5: 3,851,126 (GRCm38) L477* probably null Het
Lrriq4 A G 3: 30,660,047 (GRCm38) I515V possibly damaging Het
Magel2 A G 7: 62,381,092 (GRCm38) Y1248C unknown Het
Maml1 G T 11: 50,258,335 (GRCm38) N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 (GRCm38) H139L possibly damaging Het
Mef2d C T 3: 88,168,090 (GRCm38) P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 (GRCm38) K38E probably benign Het
Mtmr4 T C 11: 87,604,097 (GRCm38) V405A probably damaging Het
Naip5 T C 13: 100,219,696 (GRCm38) Q1137R probably benign Het
Naip5 G A 13: 100,219,687 (GRCm38) T1140M probably benign Het
Naip5 G A 13: 100,219,681 (GRCm38) S1142F probably benign Het
Nfe2l3 T C 6: 51,456,624 (GRCm38) S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 (GRCm38) I235V probably benign Het
Nyap2 T A 1: 81,241,313 (GRCm38) L318Q probably damaging Het
Nynrin G A 14: 55,872,001 (GRCm38) V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 (GRCm38) N74K probably benign Het
Olfr1461 A G 19: 13,165,124 (GRCm38) I37V probably benign Het
Olfr659 C T 7: 104,670,735 (GRCm38) P11L probably benign Het
Olfr810 T C 10: 129,791,439 (GRCm38) D50G probably damaging Het
Olfr875 T A 9: 37,773,430 (GRCm38) M257K possibly damaging Het
Oog3 A G 4: 144,159,161 (GRCm38) L289P probably damaging Het
Pax6 T C 2: 105,683,784 (GRCm38) probably benign Het
Pbrm1 G A 14: 31,110,448 (GRCm38) R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 (GRCm38) R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 (GRCm38) S747P probably benign Het
Pcnx3 A C 19: 5,687,995 (GRCm38) probably null Het
Pds5a A T 5: 65,651,289 (GRCm38) V413E probably damaging Het
Phpt1 G T 2: 25,574,320 (GRCm38) probably benign Het
Phykpl A G 11: 51,592,953 (GRCm38) E220G probably benign Het
Pias2 T C 18: 77,105,891 (GRCm38) probably null Het
Pkhd1 T A 1: 20,199,415 (GRCm38) I3302L probably damaging Het
Poli A G 18: 70,522,751 (GRCm38) L241P probably damaging Het
Ppm1h T A 10: 122,679,379 (GRCm38) I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 (GRCm38) L954P probably damaging Het
Pxk T G 14: 8,136,893 (GRCm38) M138R probably damaging Het
Rasl11b G T 5: 74,198,397 (GRCm38) D188Y probably damaging Het
Rtraf A G 14: 19,822,576 (GRCm38) F59S probably benign Het
Serpinb5 G T 1: 106,872,339 (GRCm38) L86F probably damaging Het
Setdb2 G A 14: 59,413,646 (GRCm38) T412I probably benign Het
Shank2 C A 7: 144,052,306 (GRCm38) N75K probably damaging Het
Shank3 T A 15: 89,543,115 (GRCm38) I791N probably damaging Het
Slc25a13 T A 6: 6,114,274 (GRCm38) M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 (GRCm38) Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 (GRCm38) N495S probably damaging Het
Smc2 A G 4: 52,451,231 (GRCm38) T292A probably benign Het
Spag9 T C 11: 94,048,599 (GRCm38) probably benign Het
Tas2r113 C T 6: 132,893,782 (GRCm38) P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 (GRCm38) S530G probably benign Het
Tenm2 A G 11: 36,027,290 (GRCm38) V1881A probably damaging Het
Tmcc3 G T 10: 94,578,784 (GRCm38) G147V possibly damaging Het
Trim38 A T 13: 23,788,281 (GRCm38) E195V probably damaging Het
Try5 T C 6: 41,313,415 (GRCm38) Y45C probably benign Het
Umad1 A C 6: 8,457,462 (GRCm38) probably benign Het
Vmn2r105 T C 17: 20,208,691 (GRCm38) I708V probably benign Het
Zc3h12d A T 10: 7,867,947 (GRCm38) S494C probably damaging Het
Zeb2 A G 2: 44,997,768 (GRCm38) S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 (GRCm38) S1304G probably benign Het
Zfp287 G T 11: 62,714,248 (GRCm38) T611K probably damaging Het
Zfp534 G A 4: 147,674,286 (GRCm38) T642I possibly damaging Het
Other mutations in Tm9sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Tm9sf1 APN 14 55,642,727 (GRCm38) missense probably damaging 1.00
IGL01102:Tm9sf1 APN 14 55,642,767 (GRCm38) missense probably damaging 1.00
IGL02263:Tm9sf1 APN 14 55,642,935 (GRCm38) missense possibly damaging 0.95
R0242:Tm9sf1 UTSW 14 55,637,935 (GRCm38) missense possibly damaging 0.90
R0242:Tm9sf1 UTSW 14 55,637,935 (GRCm38) missense possibly damaging 0.90
R0469:Tm9sf1 UTSW 14 55,641,429 (GRCm38) missense possibly damaging 0.87
R0928:Tm9sf1 UTSW 14 55,636,457 (GRCm38) missense probably damaging 1.00
R0973:Tm9sf1 UTSW 14 55,642,935 (GRCm38) missense possibly damaging 0.95
R0973:Tm9sf1 UTSW 14 55,642,935 (GRCm38) missense possibly damaging 0.95
R0974:Tm9sf1 UTSW 14 55,642,935 (GRCm38) missense possibly damaging 0.95
R1441:Tm9sf1 UTSW 14 55,636,325 (GRCm38) missense probably damaging 1.00
R1644:Tm9sf1 UTSW 14 55,641,300 (GRCm38) missense probably benign 0.03
R1873:Tm9sf1 UTSW 14 55,636,223 (GRCm38) missense probably damaging 1.00
R2176:Tm9sf1 UTSW 14 55,641,409 (GRCm38) missense possibly damaging 0.89
R2973:Tm9sf1 UTSW 14 55,641,114 (GRCm38) missense probably benign 0.01
R4284:Tm9sf1 UTSW 14 55,641,323 (GRCm38) missense probably damaging 1.00
R4545:Tm9sf1 UTSW 14 55,638,108 (GRCm38) missense possibly damaging 0.74
R4633:Tm9sf1 UTSW 14 55,641,203 (GRCm38) missense probably damaging 1.00
R4943:Tm9sf1 UTSW 14 55,641,168 (GRCm38) missense probably damaging 0.99
R5270:Tm9sf1 UTSW 14 55,636,481 (GRCm38) missense probably damaging 1.00
R5384:Tm9sf1 UTSW 14 55,642,844 (GRCm38) missense possibly damaging 0.80
R5385:Tm9sf1 UTSW 14 55,642,844 (GRCm38) missense possibly damaging 0.80
R5386:Tm9sf1 UTSW 14 55,642,844 (GRCm38) missense possibly damaging 0.80
R5561:Tm9sf1 UTSW 14 55,638,097 (GRCm38) missense probably damaging 1.00
R6246:Tm9sf1 UTSW 14 55,636,370 (GRCm38) missense probably damaging 1.00
R6247:Tm9sf1 UTSW 14 55,636,370 (GRCm38) missense probably damaging 1.00
R6248:Tm9sf1 UTSW 14 55,636,370 (GRCm38) missense probably damaging 1.00
R7319:Tm9sf1 UTSW 14 55,637,975 (GRCm38) unclassified probably benign
R7659:Tm9sf1 UTSW 14 55,636,335 (GRCm38) missense probably damaging 1.00
R7974:Tm9sf1 UTSW 14 55,636,449 (GRCm38) missense probably damaging 1.00
R9130:Tm9sf1 UTSW 14 55,638,007 (GRCm38) missense probably damaging 1.00
X0025:Tm9sf1 UTSW 14 55,642,836 (GRCm38) missense probably benign 0.43
X0026:Tm9sf1 UTSW 14 55,642,937 (GRCm38) start codon destroyed probably null 0.92
Predicted Primers PCR Primer
(F):5'- CCTGAGAGCAATTCATATCCCCTC -3'
(R):5'- TTGCTGGGCCTTACTCACAC -3'

Sequencing Primer
(F):5'- GCAATTCATATCCCCTCACCAGTG -3'
(R):5'- CACTTACAGTGTGCGCTGGTC -3'
Posted On 2016-02-04