Incidental Mutation 'R4816:Shank3'
ID369850
Institutional Source Beutler Lab
Gene Symbol Shank3
Ensembl Gene ENSMUSG00000022623
Gene NameSH3 and multiple ankyrin repeat domains 3
Synonyms
MMRRC Submission 042434-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R4816 (G1)
Quality Score185
Status Validated
Chromosome15
Chromosomal Location89499623-89560261 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89543115 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 791 (I791N)
Ref Sequence ENSEMBL: ENSMUSP00000104932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000066545] [ENSMUST00000109309] [ENSMUST00000167173] [ENSMUST00000229559] [ENSMUST00000230807]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039074
AA Change: I716N

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623
AA Change: I716N

DomainStartEndE-ValueType
ANK 182 211 1.54e-1 SMART
ANK 215 245 3.36e2 SMART
ANK 249 278 2.47e0 SMART
ANK 282 311 3.71e-4 SMART
ANK 315 345 5.03e2 SMART
low complexity region 434 462 N/A INTRINSIC
SH3 473 528 1.28e-14 SMART
PDZ 579 664 3.95e-13 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 813 843 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 905 923 N/A INTRINSIC
low complexity region 1078 1092 N/A INTRINSIC
low complexity region 1109 1121 N/A INTRINSIC
low complexity region 1173 1194 N/A INTRINSIC
low complexity region 1235 1252 N/A INTRINSIC
low complexity region 1266 1278 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1341 1355 N/A INTRINSIC
low complexity region 1370 1395 N/A INTRINSIC
low complexity region 1409 1427 N/A INTRINSIC
low complexity region 1552 1558 N/A INTRINSIC
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1626 1658 N/A INTRINSIC
SAM 1664 1730 3.08e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000066545
SMART Domains Protein: ENSMUSP00000064477
Gene: ENSMUSG00000022623

DomainStartEndE-ValueType
ANK 109 138 1.54e-1 SMART
ANK 142 172 3.36e2 SMART
ANK 176 205 2.47e0 SMART
ANK 209 238 3.71e-4 SMART
ANK 242 272 5.03e2 SMART
low complexity region 361 389 N/A INTRINSIC
SH3 400 455 1.28e-14 SMART
PDZ 506 591 3.95e-13 SMART
low complexity region 599 611 N/A INTRINSIC
low complexity region 625 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109309
AA Change: I791N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623
AA Change: I791N

DomainStartEndE-ValueType
low complexity region 5 55 N/A INTRINSIC
Pfam:FERM_f0 84 167 2.5e-14 PFAM
ANK 257 286 1.54e-1 SMART
ANK 290 320 3.36e2 SMART
ANK 324 353 2.47e0 SMART
ANK 357 386 3.71e-4 SMART
ANK 390 420 5.03e2 SMART
low complexity region 509 537 N/A INTRINSIC
SH3 548 603 1.28e-14 SMART
PDZ 654 739 3.95e-13 SMART
low complexity region 747 759 N/A INTRINSIC
low complexity region 888 918 N/A INTRINSIC
low complexity region 932 944 N/A INTRINSIC
low complexity region 980 998 N/A INTRINSIC
low complexity region 1153 1167 N/A INTRINSIC
low complexity region 1184 1196 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1310 1327 N/A INTRINSIC
low complexity region 1341 1353 N/A INTRINSIC
low complexity region 1393 1407 N/A INTRINSIC
low complexity region 1416 1430 N/A INTRINSIC
low complexity region 1445 1470 N/A INTRINSIC
low complexity region 1484 1502 N/A INTRINSIC
low complexity region 1627 1633 N/A INTRINSIC
low complexity region 1659 1674 N/A INTRINSIC
low complexity region 1701 1733 N/A INTRINSIC
SAM 1739 1805 3.08e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167173
AA Change: I90N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132229
Gene: ENSMUSG00000022623
AA Change: I90N

DomainStartEndE-ValueType
low complexity region 57 66 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229559
Predicted Effect probably damaging
Transcript: ENSMUST00000230807
AA Change: I308N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 97% (113/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,615,243 I248S possibly damaging Het
8030462N17Rik A T 18: 77,653,299 probably null Het
Abcc8 C A 7: 46,104,707 A1562S probably benign Het
Adam30 C A 3: 98,162,745 D631E possibly damaging Het
Adgrv1 T C 13: 81,528,674 T2013A probably damaging Het
Als2cr12 G A 1: 58,670,408 A196V probably benign Het
Baiap3 T A 17: 25,247,295 probably benign Het
Bicra T C 7: 15,988,906 T229A possibly damaging Het
C1qbp A G 11: 70,982,364 probably benign Het
C2cd3 C A 7: 100,391,019 T265K probably benign Het
Cacna1s T A 1: 136,115,269 I1331K possibly damaging Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdcp2 A G 4: 107,106,772 Y273C probably damaging Het
Cdh23 A C 10: 60,409,077 V1013G possibly damaging Het
Celf3 T A 3: 94,479,222 I39N probably damaging Het
Cep152 A C 2: 125,563,754 S1619R probably damaging Het
Cfap36 A G 11: 29,245,108 I42T probably damaging Het
Cfap61 G T 2: 146,143,100 V955L probably damaging Het
Cit G A 5: 115,908,691 D388N probably damaging Het
Clca3a2 T C 3: 144,810,852 M328V probably benign Het
Cntn4 A T 6: 106,550,497 I447L probably benign Het
Csmd3 T C 15: 47,857,934 T1538A possibly damaging Het
Cstf1 A G 2: 172,372,985 K9E probably damaging Het
Dip2c T A 13: 9,575,150 M560K probably benign Het
Dsg1a A T 18: 20,333,722 T550S probably benign Het
Dtnb A G 12: 3,749,505 E460G probably damaging Het
Dus1l GAGGTAAG GAG 11: 120,789,758 probably benign Het
Efl1 T A 7: 82,671,719 V120E probably damaging Het
Fbxl13 T C 5: 21,484,003 Y769C probably benign Het
Fcho2 T C 13: 98,806,366 Y22C probably damaging Het
Gbp3 T C 3: 142,567,574 V294A probably damaging Het
Gls A G 1: 52,199,945 probably benign Het
Gm15130 A T 2: 111,135,369 probably benign Het
Gm6185 A T 1: 161,213,158 noncoding transcript Het
Gpr171 T A 3: 59,098,096 H86L probably damaging Het
Gpr179 T C 11: 97,339,248 T694A probably damaging Het
H2-Aa A T 17: 34,283,820 V124E probably damaging Het
H2-M5 A G 17: 36,989,417 probably benign Het
Hist1h2bl A G 13: 21,715,965 M60T probably benign Het
Igf2r A T 17: 12,684,097 N2355K probably damaging Het
Il9r A C 11: 32,192,654 S295A possibly damaging Het
Ipo9 T C 1: 135,406,550 T313A probably benign Het
Kalrn C T 16: 34,514,019 probably benign Het
Lama3 G A 18: 12,477,604 V1175M possibly damaging Het
Lhpp T A 7: 132,670,375 C242* probably null Het
Lipe A G 7: 25,380,143 S1013P probably damaging Het
Lrrc25 C T 8: 70,618,076 T169I probably benign Het
Lrrc39 T C 3: 116,568,866 probably null Het
Lrrd1 T A 5: 3,851,126 L477* probably null Het
Lrriq4 A G 3: 30,660,047 I515V possibly damaging Het
Magel2 A G 7: 62,381,092 Y1248C unknown Het
Maml1 G T 11: 50,258,335 N859K possibly damaging Het
Mdm1 A T 10: 118,146,877 H139L possibly damaging Het
Mef2d C T 3: 88,168,090 P420S possibly damaging Het
Mgat4b A G 11: 50,211,021 K38E probably benign Het
Mtmr4 T C 11: 87,604,097 V405A probably damaging Het
Naip5 G A 13: 100,219,681 S1142F probably benign Het
Naip5 G A 13: 100,219,687 T1140M probably benign Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Nfe2l3 T C 6: 51,456,624 S239P probably damaging Het
Nlrp3 A G 11: 59,548,301 I235V probably benign Het
Nyap2 T A 1: 81,241,313 L318Q probably damaging Het
Nynrin G A 14: 55,872,001 V1522M probably damaging Het
Olfr1016 A T 2: 85,800,047 N74K probably benign Het
Olfr1461 A G 19: 13,165,124 I37V probably benign Het
Olfr659 C T 7: 104,670,735 P11L probably benign Het
Olfr810 T C 10: 129,791,439 D50G probably damaging Het
Olfr875 T A 9: 37,773,430 M257K possibly damaging Het
Oog3 A G 4: 144,159,161 L289P probably damaging Het
Pax6 T C 2: 105,683,784 probably benign Het
Pbrm1 G A 14: 31,110,448 R1441K probably benign Het
Pcdha9 C T 18: 36,999,458 R527W probably damaging Het
Pcdhb17 T C 18: 37,487,397 S747P probably benign Het
Pcnx3 A C 19: 5,687,995 probably null Het
Pds5a A T 5: 65,651,289 V413E probably damaging Het
Phpt1 G T 2: 25,574,320 probably benign Het
Phykpl A G 11: 51,592,953 E220G probably benign Het
Pias2 T C 18: 77,105,891 probably null Het
Pkhd1 T A 1: 20,199,415 I3302L probably damaging Het
Poli A G 18: 70,522,751 L241P probably damaging Het
Ppm1h T A 10: 122,679,379 I65N possibly damaging Het
Ptpn14 T C 1: 189,856,800 L954P probably damaging Het
Pxk T G 14: 8,136,893 M138R probably damaging Het
Rasl11b G T 5: 74,198,397 D188Y probably damaging Het
Rtraf A G 14: 19,822,576 F59S probably benign Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setdb2 G A 14: 59,413,646 T412I probably benign Het
Shank2 C A 7: 144,052,306 N75K probably damaging Het
Slc25a13 T A 6: 6,114,274 M213L possibly damaging Het
Slc25a21 T C 12: 56,713,838 Y298C probably damaging Het
Slc34a2 A G 5: 53,069,020 N495S probably damaging Het
Smc2 A G 4: 52,451,231 T292A probably benign Het
Spag9 T C 11: 94,048,599 probably benign Het
Tas2r113 C T 6: 132,893,782 P258S probably benign Het
Tbkbp1 T C 11: 97,138,741 S530G probably benign Het
Tenm2 A G 11: 36,027,290 V1881A probably damaging Het
Tm9sf1 C T 14: 55,641,149 R262Q possibly damaging Het
Tmcc3 G T 10: 94,578,784 G147V possibly damaging Het
Trim38 A T 13: 23,788,281 E195V probably damaging Het
Try5 T C 6: 41,313,415 Y45C probably benign Het
Umad1 A C 6: 8,457,462 probably benign Het
Vmn2r105 T C 17: 20,208,691 I708V probably benign Het
Zc3h12d A T 10: 7,867,947 S494C probably damaging Het
Zeb2 A G 2: 44,997,768 S382P probably damaging Het
Zfc3h1 A G 10: 115,415,694 S1304G probably benign Het
Zfp287 G T 11: 62,714,248 T611K probably damaging Het
Zfp534 G A 4: 147,674,286 T642I possibly damaging Het
Other mutations in Shank3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Shank3 APN 15 89549416 missense probably damaging 1.00
IGL01469:Shank3 APN 15 89521274 missense probably damaging 1.00
IGL01886:Shank3 APN 15 89531663 missense probably damaging 1.00
IGL01934:Shank3 APN 15 89549846 missense probably damaging 1.00
IGL01989:Shank3 APN 15 89503299 splice site probably benign
IGL02004:Shank3 APN 15 89503299 splice site probably benign
IGL02085:Shank3 APN 15 89503915 critical splice donor site probably null
IGL02195:Shank3 APN 15 89548118 missense probably damaging 1.00
IGL02354:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02361:Shank3 APN 15 89504333 missense probably damaging 1.00
IGL02541:Shank3 APN 15 89501410 missense probably damaging 1.00
R0294:Shank3 UTSW 15 89532098 missense probably damaging 1.00
R0468:Shank3 UTSW 15 89549275 missense probably benign 0.28
R0483:Shank3 UTSW 15 89543239 splice site probably benign
R0605:Shank3 UTSW 15 89524147 missense possibly damaging 0.49
R0675:Shank3 UTSW 15 89531388 missense possibly damaging 0.92
R1082:Shank3 UTSW 15 89549371 missense probably damaging 1.00
R1576:Shank3 UTSW 15 89503663 missense probably benign 0.11
R1702:Shank3 UTSW 15 89499896 missense probably damaging 0.99
R1726:Shank3 UTSW 15 89557986 missense probably damaging 1.00
R1958:Shank3 UTSW 15 89503148 missense probably damaging 0.99
R1961:Shank3 UTSW 15 89557964 missense possibly damaging 0.60
R2420:Shank3 UTSW 15 89521210 nonsense probably null
R2513:Shank3 UTSW 15 89548686 missense probably benign 0.05
R3917:Shank3 UTSW 15 89503384 missense possibly damaging 0.77
R4163:Shank3 UTSW 15 89549594 missense probably damaging 1.00
R4205:Shank3 UTSW 15 89503318 missense probably damaging 1.00
R4434:Shank3 UTSW 15 89503359 missense probably damaging 1.00
R4791:Shank3 UTSW 15 89500354 missense probably damaging 1.00
R4828:Shank3 UTSW 15 89500199 intron probably benign
R4911:Shank3 UTSW 15 89504344 missense probably damaging 1.00
R4997:Shank3 UTSW 15 89549698 missense probably damaging 1.00
R5213:Shank3 UTSW 15 89533278 missense possibly damaging 0.82
R5338:Shank3 UTSW 15 89531711 splice site probably null
R5494:Shank3 UTSW 15 89548238 missense probably damaging 0.99
R5543:Shank3 UTSW 15 89532354 missense probably damaging 1.00
R5654:Shank3 UTSW 15 89521326 missense probably benign 0.07
R5900:Shank3 UTSW 15 89503390 missense probably damaging 1.00
R5906:Shank3 UTSW 15 89548916 missense probably damaging 1.00
R6385:Shank3 UTSW 15 89521375 critical splice donor site probably null
R6432:Shank3 UTSW 15 89503413 missense possibly damaging 0.75
R6724:Shank3 UTSW 15 89532453 missense probably damaging 1.00
R6822:Shank3 UTSW 15 89531627 missense probably damaging 1.00
R6845:Shank3 UTSW 15 89548325 missense probably benign 0.00
R7088:Shank3 UTSW 15 89503525 splice site probably null
R7390:Shank3 UTSW 15 89549312 missense probably benign 0.05
R7808:Shank3 UTSW 15 89548880 missense probably damaging 1.00
R7862:Shank3 UTSW 15 89505445 missense possibly damaging 0.73
R7945:Shank3 UTSW 15 89505445 missense possibly damaging 0.73
RF020:Shank3 UTSW 15 89500390 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GTCTGCAGAGTACAGATGGTG -3'
(R):5'- ATGAGAGTTCCACCTCCTCTGG -3'

Sequencing Primer
(F):5'- GTCAGATCTAGGTCTCAGGCAG -3'
(R):5'- TCCTCTGGAGAAGGGATCC -3'
Posted On2016-02-04