Mutagenetix > Incidental Mutation

Incidental Mutation 'R4816:Shank3'

369850

Institutional Source

Beutler Lab

Gene Symbol

Shank3

Ensembl Gene

ENSMUSG00000022623

Gene Name

SH3 and multiple ankyrin repeat domains 3

Synonyms

MMRRC Submission

042434-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R4816 (G1)

Quality Score

185

Status

Validated

Chromosome

Chromosomal Location

89499623-89560261 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 89543115 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 791 (I791N)

Ref Sequence

ENSEMBL: ENSMUSP00000104932 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039074] [ENSMUST00000066545] [ENSMUST00000109309] [ENSMUST00000167173] [ENSMUST00000229559] [ENSMUST00000230807]

AlphaFold

Q4ACU6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000039074
AA Change: I716N

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000048062
Gene: ENSMUSG00000022623
AA Change: I716N

Domain	Start	End	E-Value	Type
ANK	182	211	1.54e-1	SMART
ANK	215	245	3.36e2	SMART
ANK	249	278	2.47e0	SMART
ANK	282	311	3.71e-4	SMART
ANK	315	345	5.03e2	SMART
low complexity region	434	462	N/A	INTRINSIC
SH3	473	528	1.28e-14	SMART
PDZ	579	664	3.95e-13	SMART
low complexity region	672	684	N/A	INTRINSIC
low complexity region	813	843	N/A	INTRINSIC
low complexity region	857	869	N/A	INTRINSIC
low complexity region	905	923	N/A	INTRINSIC
low complexity region	1078	1092	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1173	1194	N/A	INTRINSIC
low complexity region	1235	1252	N/A	INTRINSIC
low complexity region	1266	1278	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1341	1355	N/A	INTRINSIC
low complexity region	1370	1395	N/A	INTRINSIC
low complexity region	1409	1427	N/A	INTRINSIC
low complexity region	1552	1558	N/A	INTRINSIC
low complexity region	1584	1599	N/A	INTRINSIC
low complexity region	1626	1658	N/A	INTRINSIC
SAM	1664	1730	3.08e-18	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000066545

SMART Domains

Protein: ENSMUSP00000064477
Gene: ENSMUSG00000022623

Domain	Start	End	E-Value	Type
ANK	109	138	1.54e-1	SMART
ANK	142	172	3.36e2	SMART
ANK	176	205	2.47e0	SMART
ANK	209	238	3.71e-4	SMART
ANK	242	272	5.03e2	SMART
low complexity region	361	389	N/A	INTRINSIC
SH3	400	455	1.28e-14	SMART
PDZ	506	591	3.95e-13	SMART
low complexity region	599	611	N/A	INTRINSIC
low complexity region	625	636	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109309
AA Change: I791N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000104932
Gene: ENSMUSG00000022623
AA Change: I791N

Domain	Start	End	E-Value	Type
low complexity region	5	55	N/A	INTRINSIC
Pfam:FERM_f0	84	167	2.5e-14	PFAM
ANK	257	286	1.54e-1	SMART
ANK	290	320	3.36e2	SMART
ANK	324	353	2.47e0	SMART
ANK	357	386	3.71e-4	SMART
ANK	390	420	5.03e2	SMART
low complexity region	509	537	N/A	INTRINSIC
SH3	548	603	1.28e-14	SMART
PDZ	654	739	3.95e-13	SMART
low complexity region	747	759	N/A	INTRINSIC
low complexity region	888	918	N/A	INTRINSIC
low complexity region	932	944	N/A	INTRINSIC
low complexity region	980	998	N/A	INTRINSIC
low complexity region	1153	1167	N/A	INTRINSIC
low complexity region	1184	1196	N/A	INTRINSIC
low complexity region	1248	1269	N/A	INTRINSIC
low complexity region	1310	1327	N/A	INTRINSIC
low complexity region	1341	1353	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1416	1430	N/A	INTRINSIC
low complexity region	1445	1470	N/A	INTRINSIC
low complexity region	1484	1502	N/A	INTRINSIC
low complexity region	1627	1633	N/A	INTRINSIC
low complexity region	1659	1674	N/A	INTRINSIC
low complexity region	1701	1733	N/A	INTRINSIC
SAM	1739	1805	3.08e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167173
AA Change: I90N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000132229
Gene: ENSMUSG00000022623
AA Change: I90N

Domain	Start	End	E-Value	Type
low complexity region	57	66	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000229559

Predicted Effect

probably damaging
Transcript: ENSMUST00000230807
AA Change: I308N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

97% (113/116)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Shank gene family. Shank proteins are multidomain scaffold proteins of the postsynaptic density that connect neurotransmitter receptors, ion channels, and other membrane proteins to the actin cytoskeleton and G-protein-coupled signaling pathways. Shank proteins also play a role in synapse formation and dendritic spine maturation. Mutations in this gene are a cause of autism spectrum disorder (ASD), which is characterized by impairments in social interaction and communication, and restricted behavioral patterns and interests. Mutations in this gene also cause schizophrenia type 15, and are a major causative factor in the neurological symptoms of 22q13.3 deletion syndrome, which is also known as Phelan-McDermid syndrome. Additional isoforms have been described for this gene but they have not yet been experimentally verified. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice carrying various deletions of exons encoding the ankyrin repeats (exons 4-9) exhibit a range of synaptic and autism-related impairments. Homozygotes lacking exon 9 show altered excitation/inhibition balance, increased rearing, and mildly impaired spatial memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 107 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,615,243	I248S	possibly damaging	Het
8030462N17Rik	A	T	18: 77,653,299		probably null	Het
Abcc8	C	A	7: 46,104,707	A1562S	probably benign	Het
Adam30	C	A	3: 98,162,745	D631E	possibly damaging	Het
Adgrv1	T	C	13: 81,528,674	T2013A	probably damaging	Het
Als2cr12	G	A	1: 58,670,408	A196V	probably benign	Het
Baiap3	T	A	17: 25,247,295		probably benign	Het
Bicra	T	C	7: 15,988,906	T229A	possibly damaging	Het
C1qbp	A	G	11: 70,982,364		probably benign	Het
C2cd3	C	A	7: 100,391,019	T265K	probably benign	Het
Cacna1s	T	A	1: 136,115,269	I1331K	possibly damaging	Het
Cdadc1	AGACGGA	AGA	14: 59,568,991		probably null	Het
Cdcp2	A	G	4: 107,106,772	Y273C	probably damaging	Het
Cdh23	A	C	10: 60,409,077	V1013G	possibly damaging	Het
Celf3	T	A	3: 94,479,222	I39N	probably damaging	Het
Cep152	A	C	2: 125,563,754	S1619R	probably damaging	Het
Cfap36	A	G	11: 29,245,108	I42T	probably damaging	Het
Cfap61	G	T	2: 146,143,100	V955L	probably damaging	Het
Cit	G	A	5: 115,908,691	D388N	probably damaging	Het
Clca3a2	T	C	3: 144,810,852	M328V	probably benign	Het
Cntn4	A	T	6: 106,550,497	I447L	probably benign	Het
Csmd3	T	C	15: 47,857,934	T1538A	possibly damaging	Het
Cstf1	A	G	2: 172,372,985	K9E	probably damaging	Het
Dip2c	T	A	13: 9,575,150	M560K	probably benign	Het
Dsg1a	A	T	18: 20,333,722	T550S	probably benign	Het
Dtnb	A	G	12: 3,749,505	E460G	probably damaging	Het
Dus1l	GAGGTAAG	GAG	11: 120,789,758		probably benign	Het
Efl1	T	A	7: 82,671,719	V120E	probably damaging	Het
Fbxl13	T	C	5: 21,484,003	Y769C	probably benign	Het
Fcho2	T	C	13: 98,806,366	Y22C	probably damaging	Het
Gbp3	T	C	3: 142,567,574	V294A	probably damaging	Het
Gls	A	G	1: 52,199,945		probably benign	Het
Gm15130	A	T	2: 111,135,369		probably benign	Het
Gm6185	A	T	1: 161,213,158		noncoding transcript	Het
Gpr171	T	A	3: 59,098,096	H86L	probably damaging	Het
Gpr179	T	C	11: 97,339,248	T694A	probably damaging	Het
H2-Aa	A	T	17: 34,283,820	V124E	probably damaging	Het
H2-M5	A	G	17: 36,989,417		probably benign	Het
Hist1h2bl	A	G	13: 21,715,965	M60T	probably benign	Het
Igf2r	A	T	17: 12,684,097	N2355K	probably damaging	Het
Il9r	A	C	11: 32,192,654	S295A	possibly damaging	Het
Ipo9	T	C	1: 135,406,550	T313A	probably benign	Het
Kalrn	C	T	16: 34,514,019		probably benign	Het
Lama3	G	A	18: 12,477,604	V1175M	possibly damaging	Het
Lhpp	T	A	7: 132,670,375	C242*	probably null	Het
Lipe	A	G	7: 25,380,143	S1013P	probably damaging	Het
Lrrc25	C	T	8: 70,618,076	T169I	probably benign	Het
Lrrc39	T	C	3: 116,568,866		probably null	Het
Lrrd1	T	A	5: 3,851,126	L477*	probably null	Het
Lrriq4	A	G	3: 30,660,047	I515V	possibly damaging	Het
Magel2	A	G	7: 62,381,092	Y1248C	unknown	Het
Maml1	G	T	11: 50,258,335	N859K	possibly damaging	Het
Mdm1	A	T	10: 118,146,877	H139L	possibly damaging	Het
Mef2d	C	T	3: 88,168,090	P420S	possibly damaging	Het
Mgat4b	A	G	11: 50,211,021	K38E	probably benign	Het
Mtmr4	T	C	11: 87,604,097	V405A	probably damaging	Het
Naip5	G	A	13: 100,219,681	S1142F	probably benign	Het
Naip5	G	A	13: 100,219,687	T1140M	probably benign	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Nfe2l3	T	C	6: 51,456,624	S239P	probably damaging	Het
Nlrp3	A	G	11: 59,548,301	I235V	probably benign	Het
Nyap2	T	A	1: 81,241,313	L318Q	probably damaging	Het
Nynrin	G	A	14: 55,872,001	V1522M	probably damaging	Het
Olfr1016	A	T	2: 85,800,047	N74K	probably benign	Het
Olfr1461	A	G	19: 13,165,124	I37V	probably benign	Het
Olfr659	C	T	7: 104,670,735	P11L	probably benign	Het
Olfr810	T	C	10: 129,791,439	D50G	probably damaging	Het
Olfr875	T	A	9: 37,773,430	M257K	possibly damaging	Het
Oog3	A	G	4: 144,159,161	L289P	probably damaging	Het
Pax6	T	C	2: 105,683,784		probably benign	Het
Pbrm1	G	A	14: 31,110,448	R1441K	probably benign	Het
Pcdha9	C	T	18: 36,999,458	R527W	probably damaging	Het
Pcdhb17	T	C	18: 37,487,397	S747P	probably benign	Het
Pcnx3	A	C	19: 5,687,995		probably null	Het
Pds5a	A	T	5: 65,651,289	V413E	probably damaging	Het
Phpt1	G	T	2: 25,574,320		probably benign	Het
Phykpl	A	G	11: 51,592,953	E220G	probably benign	Het
Pias2	T	C	18: 77,105,891		probably null	Het
Pkhd1	T	A	1: 20,199,415	I3302L	probably damaging	Het
Poli	A	G	18: 70,522,751	L241P	probably damaging	Het
Ppm1h	T	A	10: 122,679,379	I65N	possibly damaging	Het
Ptpn14	T	C	1: 189,856,800	L954P	probably damaging	Het
Pxk	T	G	14: 8,136,893	M138R	probably damaging	Het
Rasl11b	G	T	5: 74,198,397	D188Y	probably damaging	Het
Rtraf	A	G	14: 19,822,576	F59S	probably benign	Het
Serpinb5	G	T	1: 106,872,339	L86F	probably damaging	Het
Setdb2	G	A	14: 59,413,646	T412I	probably benign	Het
Shank2	C	A	7: 144,052,306	N75K	probably damaging	Het
Slc25a13	T	A	6: 6,114,274	M213L	possibly damaging	Het
Slc25a21	T	C	12: 56,713,838	Y298C	probably damaging	Het
Slc34a2	A	G	5: 53,069,020	N495S	probably damaging	Het
Smc2	A	G	4: 52,451,231	T292A	probably benign	Het
Spag9	T	C	11: 94,048,599		probably benign	Het
Tas2r113	C	T	6: 132,893,782	P258S	probably benign	Het
Tbkbp1	T	C	11: 97,138,741	S530G	probably benign	Het
Tenm2	A	G	11: 36,027,290	V1881A	probably damaging	Het
Tm9sf1	C	T	14: 55,641,149	R262Q	possibly damaging	Het
Tmcc3	G	T	10: 94,578,784	G147V	possibly damaging	Het
Trim38	A	T	13: 23,788,281	E195V	probably damaging	Het
Try5	T	C	6: 41,313,415	Y45C	probably benign	Het
Umad1	A	C	6: 8,457,462		probably benign	Het
Vmn2r105	T	C	17: 20,208,691	I708V	probably benign	Het
Zc3h12d	A	T	10: 7,867,947	S494C	probably damaging	Het
Zeb2	A	G	2: 44,997,768	S382P	probably damaging	Het
Zfc3h1	A	G	10: 115,415,694	S1304G	probably benign	Het
Zfp287	G	T	11: 62,714,248	T611K	probably damaging	Het
Zfp534	G	A	4: 147,674,286	T642I	possibly damaging	Het

Other mutations in Shank3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Shank3	APN	15	89549416	missense	probably damaging	1.00
IGL01469:Shank3	APN	15	89521274	missense	probably damaging	1.00
IGL01886:Shank3	APN	15	89531663	missense	probably damaging	1.00
IGL01934:Shank3	APN	15	89549846	missense	probably damaging	1.00
IGL01989:Shank3	APN	15	89503299	splice site	probably benign
IGL02004:Shank3	APN	15	89503299	splice site	probably benign
IGL02085:Shank3	APN	15	89503915	critical splice donor site	probably null
IGL02195:Shank3	APN	15	89548118	missense	probably damaging	1.00
IGL02354:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02361:Shank3	APN	15	89504333	missense	probably damaging	1.00
IGL02541:Shank3	APN	15	89501410	missense	probably damaging	1.00
G1citation:Shank3	UTSW	15	89531627	missense	probably damaging	1.00
R0294:Shank3	UTSW	15	89532098	missense	probably damaging	1.00
R0468:Shank3	UTSW	15	89549275	missense	probably benign	0.28
R0483:Shank3	UTSW	15	89543239	splice site	probably benign
R0605:Shank3	UTSW	15	89524147	missense	possibly damaging	0.49
R0675:Shank3	UTSW	15	89531388	missense	possibly damaging	0.92
R1082:Shank3	UTSW	15	89549371	missense	probably damaging	1.00
R1576:Shank3	UTSW	15	89503663	missense	probably benign	0.11
R1702:Shank3	UTSW	15	89499896	missense	probably damaging	0.99
R1726:Shank3	UTSW	15	89557986	missense	probably damaging	1.00
R1958:Shank3	UTSW	15	89503148	missense	probably damaging	0.99
R1961:Shank3	UTSW	15	89557964	missense	possibly damaging	0.60
R2420:Shank3	UTSW	15	89521210	nonsense	probably null
R2513:Shank3	UTSW	15	89548686	missense	probably benign	0.05
R3917:Shank3	UTSW	15	89503384	missense	possibly damaging	0.77
R4163:Shank3	UTSW	15	89549594	missense	probably damaging	1.00
R4205:Shank3	UTSW	15	89503318	missense	probably damaging	1.00
R4434:Shank3	UTSW	15	89503359	missense	probably damaging	1.00
R4791:Shank3	UTSW	15	89500354	missense	probably damaging	1.00
R4828:Shank3	UTSW	15	89500199	intron	probably benign
R4911:Shank3	UTSW	15	89504344	missense	probably damaging	1.00
R4997:Shank3	UTSW	15	89549698	missense	probably damaging	1.00
R5213:Shank3	UTSW	15	89533278	missense	possibly damaging	0.82
R5338:Shank3	UTSW	15	89531711	splice site	probably null
R5494:Shank3	UTSW	15	89548238	missense	probably damaging	0.99
R5543:Shank3	UTSW	15	89532354	missense	probably damaging	1.00
R5654:Shank3	UTSW	15	89521326	missense	probably benign	0.07
R5900:Shank3	UTSW	15	89503390	missense	probably damaging	1.00
R5906:Shank3	UTSW	15	89548916	missense	probably damaging	1.00
R6385:Shank3	UTSW	15	89521375	critical splice donor site	probably null
R6432:Shank3	UTSW	15	89503413	missense	possibly damaging	0.75
R6724:Shank3	UTSW	15	89532453	missense	probably damaging	1.00
R6822:Shank3	UTSW	15	89531627	missense	probably damaging	1.00
R6845:Shank3	UTSW	15	89548325	missense	probably benign	0.00
R7088:Shank3	UTSW	15	89503525	splice site	probably null
R7390:Shank3	UTSW	15	89549312	missense	probably benign	0.05
R7808:Shank3	UTSW	15	89548880	missense	probably damaging	1.00
R7862:Shank3	UTSW	15	89505445	missense	possibly damaging	0.73
R8039:Shank3	UTSW	15	89505439	missense	probably damaging	1.00
R8090:Shank3	UTSW	15	89505458	critical splice donor site	probably null
R8170:Shank3	UTSW	15	89548840	missense	possibly damaging	0.69
R8189:Shank3	UTSW	15	89549236	missense	probably benign
R8246:Shank3	UTSW	15	89533346	missense	possibly damaging	0.90
R8515:Shank3	UTSW	15	89503572	nonsense	probably null
R8525:Shank3	UTSW	15	89547770	missense	probably damaging	0.99
R8537:Shank3	UTSW	15	89532215	missense	probably damaging	1.00
R8673:Shank3	UTSW	15	89549776	missense	probably damaging	1.00
R8826:Shank3	UTSW	15	89549395	missense	probably damaging	1.00
R8932:Shank3	UTSW	15	89548783	missense	possibly damaging	0.86
R8954:Shank3	UTSW	15	89549228	missense	possibly damaging	0.88
R8976:Shank3	UTSW	15	89558178	missense	probably damaging	1.00
R8992:Shank3	UTSW	15	89548685	missense	possibly damaging	0.95
R8994:Shank3	UTSW	15	89533213	missense	probably benign	0.27
R9130:Shank3	UTSW	15	89558216	missense	probably benign	0.19
R9258:Shank3	UTSW	15	89504318	missense	probably damaging	1.00
R9645:Shank3	UTSW	15	89525250	missense	possibly damaging	0.96
RF020:Shank3	UTSW	15	89500390	missense	probably benign	0.20
Z1177:Shank3	UTSW	15	89558322	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- GTCTGCAGAGTACAGATGGTG -3'
(R):5'- ATGAGAGTTCCACCTCCTCTGG -3'

Sequencing Primer
(F):5'- GTCAGATCTAGGTCTCAGGCAG -3'
(R):5'- TCCTCTGGAGAAGGGATCC -3'

Posted On

2016-02-04