Incidental Mutation 'R4817:Duox2'
ID369879
Institutional Source Beutler Lab
Gene Symbol Duox2
Ensembl Gene ENSMUSG00000068452
Gene Namedual oxidase 2
SynonymsA430065P05Rik
MMRRC Submission 042435-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4817 (G1)
Quality Score218
Status Validated
Chromosome2
Chromosomal Location122279247-122298165 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 122296515 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 173 (N173T)
Ref Sequence ENSEMBL: ENSMUSP00000050314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028656] [ENSMUST00000053734]
Predicted Effect probably benign
Transcript: ENSMUST00000028656
SMART Domains Protein: ENSMUSP00000028656
Gene: ENSMUSG00000027225

DomainStartEndE-ValueType
Pfam:DuoxA 10 286 5.5e-114 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000053734
AA Change: N173T

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050314
Gene: ENSMUSG00000068452
AA Change: N173T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:An_peroxidase 35 560 5e-131 PFAM
transmembrane domain 600 622 N/A INTRINSIC
EFh 823 851 3.7e-5 SMART
EFh 859 887 2.09e-4 SMART
transmembrane domain 1010 1032 N/A INTRINSIC
Pfam:Ferric_reduct 1053 1202 1.8e-22 PFAM
Pfam:FAD_binding_8 1238 1340 3.1e-20 PFAM
Pfam:NAD_binding_6 1346 1500 1.5e-33 PFAM
Meta Mutation Damage Score 0.5697 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycoprotein and a member of the NADPH oxidase family. The synthesis of thyroid hormone is catalyzed by a protein complex located at the apical membrane of thyroid follicular cells. This complex contains an iodide transporter, thyroperoxidase, and a peroxide generating system that includes this encoded protein and DUOX1. This protein is known as dual oxidase because it has both a peroxidase homology domain and a gp91phox domain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a spontaneous mutation fail to breed and are congenitally hypothyroid (low T4, high TSH), dwarf, and hearing impaired. Anterior pituitaries are dysplastic. Cochlear defects include delayed formation of the inner sulcus and tunnel of Corti and a thickened tectorial membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T A 2: 91,203,618 D44E probably damaging Het
Acp5 T C 9: 22,127,083 I307M probably benign Het
Ahsa1 A G 12: 87,273,166 D245G possibly damaging Het
Ankrd40 A G 11: 94,339,633 K316E probably benign Het
Apol9b G A 15: 77,735,888 E295K possibly damaging Het
Aqp4 C A 18: 15,399,758 G93C probably damaging Het
Arhgap21 A G 2: 20,850,156 V1465A probably benign Het
Arhgap5 C T 12: 52,519,209 P988S possibly damaging Het
Asxl3 A C 18: 22,525,454 K2174Q probably damaging Het
Brf1 A T 12: 112,972,301 I250N probably damaging Het
Calm1 A G 12: 100,203,573 probably null Het
Ccdc33 C T 9: 58,067,535 V352M probably damaging Het
Ccdc88a G T 11: 29,460,907 K464N probably benign Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdc25b T A 2: 131,193,303 I327N probably damaging Het
Cenpf G A 1: 189,682,369 H184Y possibly damaging Het
Col6a5 G A 9: 105,934,298 T674I unknown Het
Creg2 A T 1: 39,623,190 M258K probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Cyp3a44 T A 5: 145,803,755 Y25F possibly damaging Het
Degs2 T A 12: 108,689,066 R283* probably null Het
Dido1 T C 2: 180,661,416 N1565S probably benign Het
Dnah6 A T 6: 73,022,424 M4008K probably benign Het
Dnmbp C A 19: 43,849,972 G1138V probably benign Het
Drosha A C 15: 12,914,047 H1136P probably damaging Het
Dync1li1 T G 9: 114,705,094 I87M probably benign Het
E2f8 A C 7: 48,867,746 S770A probably benign Het
Efemp1 A G 11: 28,926,241 T469A probably damaging Het
Eif3f A T 7: 108,937,775 T136S probably damaging Het
Enpp5 T C 17: 44,080,980 *46R probably null Het
Epb41l4b A G 4: 57,103,428 V136A probably damaging Het
Fam186a A C 15: 99,933,538 probably benign Het
Flt4 A G 11: 49,625,415 Y115C probably damaging Het
Gal T A 19: 3,411,126 probably null Het
Galnt3 C T 2: 66,093,539 V462I possibly damaging Het
Gas2l1 A G 11: 5,061,429 S467P possibly damaging Het
Gbx1 A G 5: 24,526,206 L204P probably damaging Het
Gle1 T A 2: 29,936,211 S101T probably benign Het
Gltpd2 A C 11: 70,519,477 Q87P probably damaging Het
Gm12789 T A 4: 101,988,882 D113E probably damaging Het
Gm1966 T A 7: 106,601,230 noncoding transcript Het
Grin3b G A 10: 79,976,898 G936R probably benign Het
Gtf3c2 C T 5: 31,174,090 probably null Het
Klhl28 T C 12: 64,957,269 T157A probably benign Het
Kmt2a A G 9: 44,821,466 probably benign Het
Lamp1 A G 8: 13,172,541 T242A probably benign Het
Lhfpl5 T G 17: 28,576,326 I109S possibly damaging Het
Lhfpl5 T A 17: 28,582,988 *220R probably null Het
Map4k2 C T 19: 6,344,429 T313I probably damaging Het
Matn2 A G 15: 34,423,799 D601G probably damaging Het
Mcur1 C T 13: 43,551,671 V170M possibly damaging Het
Mettl7a3 A T 15: 100,335,333 D135V probably damaging Het
Mphosph10 T C 7: 64,392,221 probably benign Het
Nat8l G A 5: 34,001,043 A266T probably benign Het
Nckap5 G T 1: 126,027,215 D469E possibly damaging Het
Nckap5l G T 15: 99,423,186 P1238T probably damaging Het
Ngf A G 3: 102,509,840 probably benign Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Odf3l2 G A 10: 79,640,017 P238S probably damaging Het
Olfr1396 A T 11: 49,113,621 V35D probably damaging Het
Olfr450 A G 6: 42,817,962 I164V possibly damaging Het
Pclo A T 5: 14,675,031 Y1301F unknown Het
Pclo A G 5: 14,713,125 T3871A unknown Het
Peli3 T C 19: 4,932,566 E357G probably damaging Het
Pkd1 T A 17: 24,565,374 probably null Het
Pla2g2c T G 4: 138,734,334 F38C probably damaging Het
Plekha2 T A 8: 25,059,944 T126S possibly damaging Het
Polr3f T A 2: 144,534,081 *142K probably null Het
Ppcs C T 4: 119,419,146 V81M probably benign Het
Prl7a1 A G 13: 27,635,764 I169T probably damaging Het
Rbm19 C A 5: 120,133,734 probably benign Het
Rdh7 T A 10: 127,885,762 Y215F probably benign Het
Rragd T G 4: 32,995,072 S62R probably benign Het
Rtel1 T C 2: 181,355,935 S1114P possibly damaging Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setbp1 A G 18: 78,858,800 S551P probably damaging Het
Setd6 T C 8: 95,717,055 probably benign Het
Slmap A C 14: 26,462,352 M292R probably damaging Het
Srrm4 T C 5: 116,477,134 D97G unknown Het
Stk-ps2 G A 1: 46,028,965 noncoding transcript Het
Syce1 A T 7: 140,778,423 M204K probably benign Het
Syk A G 13: 52,611,206 K123R probably benign Het
Tbc1d14 A T 5: 36,571,831 S64T probably damaging Het
Traf3ip3 T C 1: 193,184,829 K295E probably damaging Het
Trp53bp2 T C 1: 182,441,805 probably null Het
Tsc2 T A 17: 24,596,742 probably null Het
Tspyl4 T A 10: 34,297,738 C75* probably null Het
Uqcc2 T C 17: 27,125,159 I52V probably benign Het
Vcp T A 4: 42,983,486 T525S probably damaging Het
Vmn2r18 A T 5: 151,585,432 probably null Het
Vmp1 A G 11: 86,602,053 V310A probably benign Het
Vps13d T A 4: 145,069,165 R3671S probably damaging Het
Wdr3 T C 3: 100,146,545 T544A possibly damaging Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp541 T A 7: 16,090,382 F1010I probably damaging Het
Zfp64 T C 2: 168,926,112 T527A probably benign Het
Zyx G T 6: 42,356,487 R449M probably damaging Het
Other mutations in Duox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Duox2 APN 2 122283575 missense probably benign
IGL00790:Duox2 APN 2 122292300 missense possibly damaging 0.63
IGL01346:Duox2 APN 2 122287202 splice site probably benign
IGL01607:Duox2 APN 2 122292319 missense probably benign 0.00
IGL01798:Duox2 APN 2 122281908 missense probably damaging 1.00
IGL02000:Duox2 APN 2 122290709 missense probably benign
IGL02219:Duox2 APN 2 122294664 missense probably benign 0.01
IGL02227:Duox2 APN 2 122285153 splice site probably benign
IGL02276:Duox2 APN 2 122294085 missense probably benign 0.00
IGL02447:Duox2 APN 2 122297468 missense probably damaging 0.98
IGL02806:Duox2 APN 2 122284666 missense probably damaging 1.00
IGL03091:Duox2 APN 2 122289474 missense probably benign 0.03
Bedazzled UTSW 2 122287121 missense possibly damaging 0.76
Immunox UTSW 2 122281871 missense probably benign
minor UTSW 2 122281496 missense probably damaging 1.00
paltry UTSW 2 122283060 critical splice donor site probably null
Recruit UTSW 2 122283897 missense possibly damaging 0.83
stumblebum UTSW 2 122284667 missense probably damaging 1.00
Two-bit UTSW 2 122281002 missense probably benign 0.42
R0049:Duox2 UTSW 2 122296686 missense possibly damaging 0.48
R0244:Duox2 UTSW 2 122291860 missense probably benign 0.00
R0281:Duox2 UTSW 2 122292304 missense probably benign 0.10
R0378:Duox2 UTSW 2 122284583 missense probably benign 0.00
R0383:Duox2 UTSW 2 122291810 critical splice donor site probably null
R0442:Duox2 UTSW 2 122289332 missense probably benign 0.08
R0524:Duox2 UTSW 2 122281836 missense possibly damaging 0.80
R0560:Duox2 UTSW 2 122291554 missense probably benign 0.04
R0562:Duox2 UTSW 2 122289599 missense probably damaging 1.00
R0645:Duox2 UTSW 2 122292658 missense probably damaging 1.00
R0704:Duox2 UTSW 2 122284768 missense probably benign 0.01
R0963:Duox2 UTSW 2 122287172 missense probably benign 0.03
R1254:Duox2 UTSW 2 122283478 missense probably damaging 1.00
R1442:Duox2 UTSW 2 122281751 missense probably benign 0.20
R1473:Duox2 UTSW 2 122287121 missense possibly damaging 0.76
R1489:Duox2 UTSW 2 122293396 missense probably benign
R1738:Duox2 UTSW 2 122293414 missense probably damaging 1.00
R1748:Duox2 UTSW 2 122287051 missense probably benign 0.00
R1809:Duox2 UTSW 2 122283897 missense possibly damaging 0.83
R1843:Duox2 UTSW 2 122292258 critical splice donor site probably null
R1903:Duox2 UTSW 2 122295351 missense probably damaging 1.00
R1962:Duox2 UTSW 2 122297372 splice site probably null
R2069:Duox2 UTSW 2 122287108 missense probably benign 0.01
R2073:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2074:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2075:Duox2 UTSW 2 122295158 missense probably damaging 1.00
R2085:Duox2 UTSW 2 122280967 missense probably damaging 1.00
R3123:Duox2 UTSW 2 122281073 splice site probably benign
R3907:Duox2 UTSW 2 122283060 critical splice donor site probably null
R4572:Duox2 UTSW 2 122281726 missense probably benign 0.00
R4614:Duox2 UTSW 2 122289557 missense probably damaging 1.00
R4675:Duox2 UTSW 2 122280933 missense probably damaging 1.00
R4770:Duox2 UTSW 2 122284916 missense probably benign 0.01
R4931:Duox2 UTSW 2 122296755 missense probably benign 0.01
R5138:Duox2 UTSW 2 122297531 missense probably damaging 1.00
R5288:Duox2 UTSW 2 122295136 missense probably benign
R5344:Duox2 UTSW 2 122281871 missense probably benign
R5385:Duox2 UTSW 2 122295136 missense probably benign
R5386:Duox2 UTSW 2 122295136 missense probably benign
R5493:Duox2 UTSW 2 122281496 missense probably damaging 1.00
R5632:Duox2 UTSW 2 122281455 missense probably damaging 1.00
R5742:Duox2 UTSW 2 122284921 missense probably benign 0.00
R6228:Duox2 UTSW 2 122287193 missense probably benign 0.38
R6380:Duox2 UTSW 2 122281002 missense probably benign 0.42
R6398:Duox2 UTSW 2 122296370 missense probably benign 0.06
R6409:Duox2 UTSW 2 122284667 missense probably damaging 1.00
R6527:Duox2 UTSW 2 122294614 missense probably benign 0.29
R6596:Duox2 UTSW 2 122285338 missense probably benign
R6719:Duox2 UTSW 2 122284386 intron probably null
R6981:Duox2 UTSW 2 122291227 missense possibly damaging 0.95
R7036:Duox2 UTSW 2 122280453 missense probably damaging 1.00
R7073:Duox2 UTSW 2 122289307 missense probably damaging 1.00
R7105:Duox2 UTSW 2 122289552 missense possibly damaging 0.93
R7127:Duox2 UTSW 2 122291949 missense probably benign 0.02
R7259:Duox2 UTSW 2 122295176 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTGCCTCTAACCCTACAC -3'
(R):5'- CAGAGTTCCTCAACATTTACATCC -3'

Sequencing Primer
(F):5'- CCTACACCTCCTGCCAGG -3'
(R):5'- TTTCAAAGGAGCCGCTGG -3'
Posted On2016-02-04