Incidental Mutation 'R4817:Rbm19'
ID369903
Institutional Source Beutler Lab
Gene Symbol Rbm19
Ensembl Gene ENSMUSG00000029594
Gene NameRNA binding motif protein 19
Synonyms1200009A02Rik
MMRRC Submission 042435-MU
Accession Numbers

Genbank: NM_028762 ; MGI: 1921361

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4817 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location120116465-120198981 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 120133734 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031590] [ENSMUST00000202777]
Predicted Effect probably benign
Transcript: ENSMUST00000031590
SMART Domains Protein: ENSMUSP00000031590
Gene: ENSMUSG00000029594

DomainStartEndE-ValueType
RRM 3 75 7.64e-20 SMART
Pfam:RRM_u2 81 277 1.7e-10 PFAM
RRM 294 364 9.14e-9 SMART
RRM 401 474 6.4e-22 SMART
RRM 585 652 1.6e-4 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 4.59e-23 SMART
RRM 825 900 9.4e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181905
Predicted Effect probably benign
Transcript: ENSMUST00000202777
SMART Domains Protein: ENSMUSP00000144339
Gene: ENSMUSG00000029594

DomainStartEndE-ValueType
RRM 3 75 3.3e-22 SMART
Pfam:RRM_u2 81 269 1.2e-6 PFAM
RRM 294 364 3.9e-11 SMART
RRM 401 474 2.7e-24 SMART
RRM 585 652 7e-7 SMART
coiled coil region 694 717 N/A INTRINSIC
RRM 723 799 2e-25 SMART
Pfam:RRM_6 826 865 1.1e-3 PFAM
Pfam:RRM_1 826 870 8.5e-6 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein that contains six RNA-binding motifs. The encoded protein may be involved in regulating ribosome biogenesis. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit failure to undergo compaction, growth arrest at the morula stage, and apoptosis such that no embryos are observed at E6.5. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T A 2: 91,203,618 D44E probably damaging Het
Acp5 T C 9: 22,127,083 I307M probably benign Het
Ahsa1 A G 12: 87,273,166 D245G possibly damaging Het
Ankrd40 A G 11: 94,339,633 K316E probably benign Het
Apol9b G A 15: 77,735,888 E295K possibly damaging Het
Aqp4 C A 18: 15,399,758 G93C probably damaging Het
Arhgap21 A G 2: 20,850,156 V1465A probably benign Het
Arhgap5 C T 12: 52,519,209 P988S possibly damaging Het
Asxl3 A C 18: 22,525,454 K2174Q probably damaging Het
Brf1 A T 12: 112,972,301 I250N probably damaging Het
Calm1 A G 12: 100,203,573 probably null Het
Ccdc33 C T 9: 58,067,535 V352M probably damaging Het
Ccdc88a G T 11: 29,460,907 K464N probably benign Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdc25b T A 2: 131,193,303 I327N probably damaging Het
Cenpf G A 1: 189,682,369 H184Y possibly damaging Het
Col6a5 G A 9: 105,934,298 T674I unknown Het
Creg2 A T 1: 39,623,190 M258K probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Cyp3a44 T A 5: 145,803,755 Y25F possibly damaging Het
Degs2 T A 12: 108,689,066 R283* probably null Het
Dido1 T C 2: 180,661,416 N1565S probably benign Het
Dnah6 A T 6: 73,022,424 M4008K probably benign Het
Dnmbp C A 19: 43,849,972 G1138V probably benign Het
Drosha A C 15: 12,914,047 H1136P probably damaging Het
Duox2 T G 2: 122,296,515 N173T probably damaging Het
Dync1li1 T G 9: 114,705,094 I87M probably benign Het
E2f8 A C 7: 48,867,746 S770A probably benign Het
Efemp1 A G 11: 28,926,241 T469A probably damaging Het
Eif3f A T 7: 108,937,775 T136S probably damaging Het
Enpp5 T C 17: 44,080,980 *46R probably null Het
Epb41l4b A G 4: 57,103,428 V136A probably damaging Het
Fam186a A C 15: 99,933,538 probably benign Het
Flt4 A G 11: 49,625,415 Y115C probably damaging Het
Gal T A 19: 3,411,126 probably null Het
Galnt3 C T 2: 66,093,539 V462I possibly damaging Het
Gas2l1 A G 11: 5,061,429 S467P possibly damaging Het
Gbx1 A G 5: 24,526,206 L204P probably damaging Het
Gle1 T A 2: 29,936,211 S101T probably benign Het
Gltpd2 A C 11: 70,519,477 Q87P probably damaging Het
Gm12789 T A 4: 101,988,882 D113E probably damaging Het
Gm1966 T A 7: 106,601,230 noncoding transcript Het
Grin3b G A 10: 79,976,898 G936R probably benign Het
Gtf3c2 C T 5: 31,174,090 probably null Het
Klhl28 T C 12: 64,957,269 T157A probably benign Het
Kmt2a A G 9: 44,821,466 probably benign Het
Lamp1 A G 8: 13,172,541 T242A probably benign Het
Lhfpl5 T A 17: 28,582,988 *220R probably null Het
Lhfpl5 T G 17: 28,576,326 I109S possibly damaging Het
Map4k2 C T 19: 6,344,429 T313I probably damaging Het
Matn2 A G 15: 34,423,799 D601G probably damaging Het
Mcur1 C T 13: 43,551,671 V170M possibly damaging Het
Mettl7a3 A T 15: 100,335,333 D135V probably damaging Het
Mphosph10 T C 7: 64,392,221 probably benign Het
Nat8l G A 5: 34,001,043 A266T probably benign Het
Nckap5 G T 1: 126,027,215 D469E possibly damaging Het
Nckap5l G T 15: 99,423,186 P1238T probably damaging Het
Ngf A G 3: 102,509,840 probably benign Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Odf3l2 G A 10: 79,640,017 P238S probably damaging Het
Olfr1396 A T 11: 49,113,621 V35D probably damaging Het
Olfr450 A G 6: 42,817,962 I164V possibly damaging Het
Pclo A T 5: 14,675,031 Y1301F unknown Het
Pclo A G 5: 14,713,125 T3871A unknown Het
Peli3 T C 19: 4,932,566 E357G probably damaging Het
Pkd1 T A 17: 24,565,374 probably null Het
Pla2g2c T G 4: 138,734,334 F38C probably damaging Het
Plekha2 T A 8: 25,059,944 T126S possibly damaging Het
Polr3f T A 2: 144,534,081 *142K probably null Het
Ppcs C T 4: 119,419,146 V81M probably benign Het
Prl7a1 A G 13: 27,635,764 I169T probably damaging Het
Rdh7 T A 10: 127,885,762 Y215F probably benign Het
Rragd T G 4: 32,995,072 S62R probably benign Het
Rtel1 T C 2: 181,355,935 S1114P possibly damaging Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setbp1 A G 18: 78,858,800 S551P probably damaging Het
Setd6 T C 8: 95,717,055 probably benign Het
Slmap A C 14: 26,462,352 M292R probably damaging Het
Srrm4 T C 5: 116,477,134 D97G unknown Het
Stk-ps2 G A 1: 46,028,965 noncoding transcript Het
Syce1 A T 7: 140,778,423 M204K probably benign Het
Syk A G 13: 52,611,206 K123R probably benign Het
Tbc1d14 A T 5: 36,571,831 S64T probably damaging Het
Traf3ip3 T C 1: 193,184,829 K295E probably damaging Het
Trp53bp2 T C 1: 182,441,805 probably null Het
Tsc2 T A 17: 24,596,742 probably null Het
Tspyl4 T A 10: 34,297,738 C75* probably null Het
Uqcc2 T C 17: 27,125,159 I52V probably benign Het
Vcp T A 4: 42,983,486 T525S probably damaging Het
Vmn2r18 A T 5: 151,585,432 probably null Het
Vmp1 A G 11: 86,602,053 V310A probably benign Het
Vps13d T A 4: 145,069,165 R3671S probably damaging Het
Wdr3 T C 3: 100,146,545 T544A possibly damaging Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp541 T A 7: 16,090,382 F1010I probably damaging Het
Zfp64 T C 2: 168,926,112 T527A probably benign Het
Zyx G T 6: 42,356,487 R449M probably damaging Het
Other mutations in Rbm19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01443:Rbm19 APN 5 120143438 splice site probably benign
IGL01750:Rbm19 APN 5 120118792 missense probably benign 0.00
IGL01830:Rbm19 APN 5 120124695 missense possibly damaging 0.95
IGL02028:Rbm19 APN 5 120120236 missense probably damaging 1.00
IGL02262:Rbm19 APN 5 120143405 missense probably damaging 0.99
IGL03030:Rbm19 APN 5 120131246 missense probably damaging 1.00
IGL03094:Rbm19 APN 5 120122958 missense probably damaging 1.00
N/A:Rbm19 UTSW 5 120144097 missense probably damaging 0.99
PIT4812001:Rbm19 UTSW 5 120128250 missense possibly damaging 0.91
R0190:Rbm19 UTSW 5 120144046 missense probably benign 0.30
R0350:Rbm19 UTSW 5 120128307 missense possibly damaging 0.75
R0594:Rbm19 UTSW 5 120128316 critical splice donor site probably null
R0924:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0930:Rbm19 UTSW 5 120126204 missense probably benign 0.11
R0963:Rbm19 UTSW 5 120130734 missense possibly damaging 0.83
R1144:Rbm19 UTSW 5 120123016 missense possibly damaging 0.87
R1438:Rbm19 UTSW 5 120122896 missense probably benign 0.01
R1441:Rbm19 UTSW 5 120131176 missense probably damaging 1.00
R1458:Rbm19 UTSW 5 120144029 missense probably benign 0.00
R1518:Rbm19 UTSW 5 120140280 small deletion probably benign
R1992:Rbm19 UTSW 5 120133883 critical splice donor site probably null
R2029:Rbm19 UTSW 5 120120242 missense possibly damaging 0.85
R3055:Rbm19 UTSW 5 120133010 missense probably damaging 1.00
R4356:Rbm19 UTSW 5 120140362 missense possibly damaging 0.72
R4808:Rbm19 UTSW 5 120118774 missense probably damaging 0.99
R4857:Rbm19 UTSW 5 120132833 splice site probably benign
R4963:Rbm19 UTSW 5 120141566 missense probably damaging 1.00
R5812:Rbm19 UTSW 5 120141577 missense probably damaging 1.00
R5857:Rbm19 UTSW 5 120132942 missense probably damaging 1.00
R5878:Rbm19 UTSW 5 120132867 missense probably damaging 1.00
R5976:Rbm19 UTSW 5 120140307 missense probably benign 0.01
R6345:Rbm19 UTSW 5 120127040 missense possibly damaging 0.87
R6489:Rbm19 UTSW 5 120120130 missense probably benign 0.06
R6495:Rbm19 UTSW 5 120119680 missense probably damaging 1.00
R7081:Rbm19 UTSW 5 120123151 critical splice donor site probably null
R7181:Rbm19 UTSW 5 120116467 unclassified probably benign
R7307:Rbm19 UTSW 5 120186218 missense possibly damaging 0.55
R8058:Rbm19 UTSW 5 120140375 critical splice donor site probably null
R8432:Rbm19 UTSW 5 120175926 missense probably damaging 1.00
R8696:Rbm19 UTSW 5 120127067 missense probably damaging 0.98
R8910:Rbm19 UTSW 5 120133779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTACATTAGTGTCTGCGGGCTC -3'
(R):5'- TGGCCTAATGACAGTCTCCC -3'

Sequencing Primer
(F):5'- CTGCTCAGGTACCTGGTTGTACAG -3'
(R):5'- TAATGACAGTCTCCCCCACC -3'
Posted On2016-02-04