Incidental Mutation 'R4817:Flt4'
ID369929
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission 042435-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4817 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49625415 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 115 (Y115C)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect probably damaging
Transcript: ENSMUST00000020617
AA Change: Y115C

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: Y115C

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152253
Meta Mutation Damage Score 0.1035 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T A 2: 91,203,618 D44E probably damaging Het
Acp5 T C 9: 22,127,083 I307M probably benign Het
Ahsa1 A G 12: 87,273,166 D245G possibly damaging Het
Ankrd40 A G 11: 94,339,633 K316E probably benign Het
Apol9b G A 15: 77,735,888 E295K possibly damaging Het
Aqp4 C A 18: 15,399,758 G93C probably damaging Het
Arhgap21 A G 2: 20,850,156 V1465A probably benign Het
Arhgap5 C T 12: 52,519,209 P988S possibly damaging Het
Asxl3 A C 18: 22,525,454 K2174Q probably damaging Het
Brf1 A T 12: 112,972,301 I250N probably damaging Het
Calm1 A G 12: 100,203,573 probably null Het
Ccdc33 C T 9: 58,067,535 V352M probably damaging Het
Ccdc88a G T 11: 29,460,907 K464N probably benign Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdc25b T A 2: 131,193,303 I327N probably damaging Het
Cenpf G A 1: 189,682,369 H184Y possibly damaging Het
Col6a5 G A 9: 105,934,298 T674I unknown Het
Creg2 A T 1: 39,623,190 M258K probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Cyp3a44 T A 5: 145,803,755 Y25F possibly damaging Het
Degs2 T A 12: 108,689,066 R283* probably null Het
Dido1 T C 2: 180,661,416 N1565S probably benign Het
Dnah6 A T 6: 73,022,424 M4008K probably benign Het
Dnmbp C A 19: 43,849,972 G1138V probably benign Het
Drosha A C 15: 12,914,047 H1136P probably damaging Het
Duox2 T G 2: 122,296,515 N173T probably damaging Het
Dync1li1 T G 9: 114,705,094 I87M probably benign Het
E2f8 A C 7: 48,867,746 S770A probably benign Het
Efemp1 A G 11: 28,926,241 T469A probably damaging Het
Eif3f A T 7: 108,937,775 T136S probably damaging Het
Enpp5 T C 17: 44,080,980 *46R probably null Het
Epb41l4b A G 4: 57,103,428 V136A probably damaging Het
Fam186a A C 15: 99,933,538 probably benign Het
Gal T A 19: 3,411,126 probably null Het
Galnt3 C T 2: 66,093,539 V462I possibly damaging Het
Gas2l1 A G 11: 5,061,429 S467P possibly damaging Het
Gbx1 A G 5: 24,526,206 L204P probably damaging Het
Gle1 T A 2: 29,936,211 S101T probably benign Het
Gltpd2 A C 11: 70,519,477 Q87P probably damaging Het
Gm12789 T A 4: 101,988,882 D113E probably damaging Het
Gm1966 T A 7: 106,601,230 noncoding transcript Het
Grin3b G A 10: 79,976,898 G936R probably benign Het
Gtf3c2 C T 5: 31,174,090 probably null Het
Klhl28 T C 12: 64,957,269 T157A probably benign Het
Kmt2a A G 9: 44,821,466 probably benign Het
Lamp1 A G 8: 13,172,541 T242A probably benign Het
Lhfpl5 T G 17: 28,576,326 I109S possibly damaging Het
Lhfpl5 T A 17: 28,582,988 *220R probably null Het
Map4k2 C T 19: 6,344,429 T313I probably damaging Het
Matn2 A G 15: 34,423,799 D601G probably damaging Het
Mcur1 C T 13: 43,551,671 V170M possibly damaging Het
Mettl7a3 A T 15: 100,335,333 D135V probably damaging Het
Mphosph10 T C 7: 64,392,221 probably benign Het
Nat8l G A 5: 34,001,043 A266T probably benign Het
Nckap5 G T 1: 126,027,215 D469E possibly damaging Het
Nckap5l G T 15: 99,423,186 P1238T probably damaging Het
Ngf A G 3: 102,509,840 probably benign Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Odf3l2 G A 10: 79,640,017 P238S probably damaging Het
Olfr1396 A T 11: 49,113,621 V35D probably damaging Het
Olfr450 A G 6: 42,817,962 I164V possibly damaging Het
Pclo A T 5: 14,675,031 Y1301F unknown Het
Pclo A G 5: 14,713,125 T3871A unknown Het
Peli3 T C 19: 4,932,566 E357G probably damaging Het
Pkd1 T A 17: 24,565,374 probably null Het
Pla2g2c T G 4: 138,734,334 F38C probably damaging Het
Plekha2 T A 8: 25,059,944 T126S possibly damaging Het
Polr3f T A 2: 144,534,081 *142K probably null Het
Ppcs C T 4: 119,419,146 V81M probably benign Het
Prl7a1 A G 13: 27,635,764 I169T probably damaging Het
Rbm19 C A 5: 120,133,734 probably benign Het
Rdh7 T A 10: 127,885,762 Y215F probably benign Het
Rragd T G 4: 32,995,072 S62R probably benign Het
Rtel1 T C 2: 181,355,935 S1114P possibly damaging Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setbp1 A G 18: 78,858,800 S551P probably damaging Het
Setd6 T C 8: 95,717,055 probably benign Het
Slmap A C 14: 26,462,352 M292R probably damaging Het
Srrm4 T C 5: 116,477,134 D97G unknown Het
Stk-ps2 G A 1: 46,028,965 noncoding transcript Het
Syce1 A T 7: 140,778,423 M204K probably benign Het
Syk A G 13: 52,611,206 K123R probably benign Het
Tbc1d14 A T 5: 36,571,831 S64T probably damaging Het
Traf3ip3 T C 1: 193,184,829 K295E probably damaging Het
Trp53bp2 T C 1: 182,441,805 probably null Het
Tsc2 T A 17: 24,596,742 probably null Het
Tspyl4 T A 10: 34,297,738 C75* probably null Het
Uqcc2 T C 17: 27,125,159 I52V probably benign Het
Vcp T A 4: 42,983,486 T525S probably damaging Het
Vmn2r18 A T 5: 151,585,432 probably null Het
Vmp1 A G 11: 86,602,053 V310A probably benign Het
Vps13d T A 4: 145,069,165 R3671S probably damaging Het
Wdr3 T C 3: 100,146,545 T544A possibly damaging Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp541 T A 7: 16,090,382 F1010I probably damaging Het
Zfp64 T C 2: 168,926,112 T527A probably benign Het
Zyx G T 6: 42,356,487 R449M probably damaging Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5527:Flt4 UTSW 11 49634754 missense probably damaging 1.00
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAATTCTCTGCTAGGGGACAGC -3'
(R):5'- CCATGGGTTAGGGTGAAGTTCC -3'

Sequencing Primer
(F):5'- ACAGCACCCCCTCGAGTG -3'
(R):5'- TGAAGTTCCAGCCTGCTG -3'
Posted On2016-02-04