Incidental Mutation 'R4817:Calm1'
ID369936
Institutional Source Beutler Lab
Gene Symbol Calm1
Ensembl Gene ENSMUSG00000001175
Gene Namecalmodulin 1
Synonyms
MMRRC Submission 042435-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.524) question?
Stock #R4817 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location100199435-100209814 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to G at 100203573 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001204] [ENSMUST00000110082]
Predicted Effect probably null
Transcript: ENSMUST00000001204
SMART Domains Protein: ENSMUSP00000001204
Gene: ENSMUSG00000001175

DomainStartEndE-ValueType
low complexity region 34 50 N/A INTRINSIC
EFh 60 88 6.39e-9 SMART
EFh 96 124 5.19e-9 SMART
EFh 133 161 3.67e-9 SMART
EFh 169 197 1.13e-9 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110082
SMART Domains Protein: ENSMUSP00000105709
Gene: ENSMUSG00000001175

DomainStartEndE-ValueType
EFh 12 40 6.39e-9 SMART
EFh 48 76 5.19e-9 SMART
EFh 85 113 3.67e-9 SMART
EFh 121 149 1.13e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153524
Meta Mutation Damage Score 0.9600 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: This gene encodes a member of the EF-hand calcium-binding protein family. The encoded protein acts as a calcium sensor and is involved in relaying signals to calcium-sensitive proteins, enzymes and ion channels. The protein-calcium complex binds target proteins to regulate several cellular processes, including smooth muscle contraction, inflammation, apoptosis and the immune response. Mutations in the human gene are associated with catecholaminergic polymorphic ventricular tachycardia and long QT syndrome 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T A 2: 91,203,618 D44E probably damaging Het
Acp5 T C 9: 22,127,083 I307M probably benign Het
Ahsa1 A G 12: 87,273,166 D245G possibly damaging Het
Ankrd40 A G 11: 94,339,633 K316E probably benign Het
Apol9b G A 15: 77,735,888 E295K possibly damaging Het
Aqp4 C A 18: 15,399,758 G93C probably damaging Het
Arhgap21 A G 2: 20,850,156 V1465A probably benign Het
Arhgap5 C T 12: 52,519,209 P988S possibly damaging Het
Asxl3 A C 18: 22,525,454 K2174Q probably damaging Het
Brf1 A T 12: 112,972,301 I250N probably damaging Het
Ccdc33 C T 9: 58,067,535 V352M probably damaging Het
Ccdc88a G T 11: 29,460,907 K464N probably benign Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdc25b T A 2: 131,193,303 I327N probably damaging Het
Cenpf G A 1: 189,682,369 H184Y possibly damaging Het
Col6a5 G A 9: 105,934,298 T674I unknown Het
Creg2 A T 1: 39,623,190 M258K probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Cyp3a44 T A 5: 145,803,755 Y25F possibly damaging Het
Degs2 T A 12: 108,689,066 R283* probably null Het
Dido1 T C 2: 180,661,416 N1565S probably benign Het
Dnah6 A T 6: 73,022,424 M4008K probably benign Het
Dnmbp C A 19: 43,849,972 G1138V probably benign Het
Drosha A C 15: 12,914,047 H1136P probably damaging Het
Duox2 T G 2: 122,296,515 N173T probably damaging Het
Dync1li1 T G 9: 114,705,094 I87M probably benign Het
E2f8 A C 7: 48,867,746 S770A probably benign Het
Efemp1 A G 11: 28,926,241 T469A probably damaging Het
Eif3f A T 7: 108,937,775 T136S probably damaging Het
Enpp5 T C 17: 44,080,980 *46R probably null Het
Epb41l4b A G 4: 57,103,428 V136A probably damaging Het
Fam186a A C 15: 99,933,538 probably benign Het
Flt4 A G 11: 49,625,415 Y115C probably damaging Het
Gal T A 19: 3,411,126 probably null Het
Galnt3 C T 2: 66,093,539 V462I possibly damaging Het
Gas2l1 A G 11: 5,061,429 S467P possibly damaging Het
Gbx1 A G 5: 24,526,206 L204P probably damaging Het
Gle1 T A 2: 29,936,211 S101T probably benign Het
Gltpd2 A C 11: 70,519,477 Q87P probably damaging Het
Gm12789 T A 4: 101,988,882 D113E probably damaging Het
Gm1966 T A 7: 106,601,230 noncoding transcript Het
Grin3b G A 10: 79,976,898 G936R probably benign Het
Gtf3c2 C T 5: 31,174,090 probably null Het
Klhl28 T C 12: 64,957,269 T157A probably benign Het
Kmt2a A G 9: 44,821,466 probably benign Het
Lamp1 A G 8: 13,172,541 T242A probably benign Het
Lhfpl5 T G 17: 28,576,326 I109S possibly damaging Het
Lhfpl5 T A 17: 28,582,988 *220R probably null Het
Map4k2 C T 19: 6,344,429 T313I probably damaging Het
Matn2 A G 15: 34,423,799 D601G probably damaging Het
Mcur1 C T 13: 43,551,671 V170M possibly damaging Het
Mettl7a3 A T 15: 100,335,333 D135V probably damaging Het
Mphosph10 T C 7: 64,392,221 probably benign Het
Nat8l G A 5: 34,001,043 A266T probably benign Het
Nckap5 G T 1: 126,027,215 D469E possibly damaging Het
Nckap5l G T 15: 99,423,186 P1238T probably damaging Het
Ngf A G 3: 102,509,840 probably benign Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Odf3l2 G A 10: 79,640,017 P238S probably damaging Het
Olfr1396 A T 11: 49,113,621 V35D probably damaging Het
Olfr450 A G 6: 42,817,962 I164V possibly damaging Het
Pclo A T 5: 14,675,031 Y1301F unknown Het
Pclo A G 5: 14,713,125 T3871A unknown Het
Peli3 T C 19: 4,932,566 E357G probably damaging Het
Pkd1 T A 17: 24,565,374 probably null Het
Pla2g2c T G 4: 138,734,334 F38C probably damaging Het
Plekha2 T A 8: 25,059,944 T126S possibly damaging Het
Polr3f T A 2: 144,534,081 *142K probably null Het
Ppcs C T 4: 119,419,146 V81M probably benign Het
Prl7a1 A G 13: 27,635,764 I169T probably damaging Het
Rbm19 C A 5: 120,133,734 probably benign Het
Rdh7 T A 10: 127,885,762 Y215F probably benign Het
Rragd T G 4: 32,995,072 S62R probably benign Het
Rtel1 T C 2: 181,355,935 S1114P possibly damaging Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setbp1 A G 18: 78,858,800 S551P probably damaging Het
Setd6 T C 8: 95,717,055 probably benign Het
Slmap A C 14: 26,462,352 M292R probably damaging Het
Srrm4 T C 5: 116,477,134 D97G unknown Het
Stk-ps2 G A 1: 46,028,965 noncoding transcript Het
Syce1 A T 7: 140,778,423 M204K probably benign Het
Syk A G 13: 52,611,206 K123R probably benign Het
Tbc1d14 A T 5: 36,571,831 S64T probably damaging Het
Traf3ip3 T C 1: 193,184,829 K295E probably damaging Het
Trp53bp2 T C 1: 182,441,805 probably null Het
Tsc2 T A 17: 24,596,742 probably null Het
Tspyl4 T A 10: 34,297,738 C75* probably null Het
Uqcc2 T C 17: 27,125,159 I52V probably benign Het
Vcp T A 4: 42,983,486 T525S probably damaging Het
Vmn2r18 A T 5: 151,585,432 probably null Het
Vmp1 A G 11: 86,602,053 V310A probably benign Het
Vps13d T A 4: 145,069,165 R3671S probably damaging Het
Wdr3 T C 3: 100,146,545 T544A possibly damaging Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp541 T A 7: 16,090,382 F1010I probably damaging Het
Zfp64 T C 2: 168,926,112 T527A probably benign Het
Zyx G T 6: 42,356,487 R449M probably damaging Het
Other mutations in Calm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02281:Calm1 APN 12 100205624 missense probably damaging 1.00
R4727:Calm1 UTSW 12 100200226 missense probably benign 0.08
R5187:Calm1 UTSW 12 100200213 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TTATTGAGCCTGGTCACTAGTG -3'
(R):5'- GCACACAGCTTTGCTCTAGG -3'

Sequencing Primer
(F):5'- CACTAGTGTTTGTTTTCTGGGCTAC -3'
(R):5'- CTTGAACTACACAATATCCCTGGTG -3'
Posted On2016-02-04