Incidental Mutation 'R4817:Brf1'
ID369938
Institutional Source Beutler Lab
Gene Symbol Brf1
Ensembl Gene ENSMUSG00000011158
Gene NameBRF1, RNA polymerase III transcription initiation factor 90 kDa subunit
SynonymsGTF3B, 2510002F24Rik, TAFIII90, TFIIIB90, TAF3C
MMRRC Submission 042435-MU
Accession Numbers

Genbank: NM_028193; MGI: 1919558

Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4817 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112960085-113000704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112972301 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 250 (I250N)
Ref Sequence ENSEMBL: ENSMUSP00000011302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002880] [ENSMUST00000011302] [ENSMUST00000165079] [ENSMUST00000221104] [ENSMUST00000221500] [ENSMUST00000222209] [ENSMUST00000223287] [ENSMUST00000223368]
Predicted Effect probably benign
Transcript: ENSMUST00000002880
SMART Domains Protein: ENSMUSP00000002880
Gene: ENSMUSG00000002803

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 25 40 N/A INTRINSIC
low complexity region 43 55 N/A INTRINSIC
low complexity region 58 68 N/A INTRINSIC
low complexity region 86 106 N/A INTRINSIC
BTB 137 237 1.39e-23 SMART
BACK 243 352 2.81e-14 SMART
Pfam:PHR 393 538 1.2e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000011302
AA Change: I250N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158
AA Change: I250N

DomainStartEndE-ValueType
Pfam:TF_Zn_Ribbon 4 46 4.3e-17 PFAM
CYCLIN 91 172 1.93e-12 SMART
CYCLIN 185 269 1.22e-9 SMART
coiled coil region 298 334 N/A INTRINSIC
low complexity region 362 374 N/A INTRINSIC
low complexity region 431 444 N/A INTRINSIC
Pfam:BRF1 452 545 3.3e-29 PFAM
low complexity region 638 650 N/A INTRINSIC
low complexity region 662 675 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165079
SMART Domains Protein: ENSMUSP00000127286
Gene: ENSMUSG00000002803

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
low complexity region 35 55 N/A INTRINSIC
BTB 86 186 1.39e-23 SMART
BACK 192 301 2.81e-14 SMART
Pfam:PHR 342 488 8.7e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220567
Predicted Effect probably benign
Transcript: ENSMUST00000221104
Predicted Effect probably benign
Transcript: ENSMUST00000221500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222117
Predicted Effect probably benign
Transcript: ENSMUST00000222209
Predicted Effect probably benign
Transcript: ENSMUST00000223287
Predicted Effect probably benign
Transcript: ENSMUST00000223368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223506
Predicted Effect probably benign
Transcript: ENSMUST00000223508
Meta Mutation Damage Score 0.8771 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]
Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T A 2: 91,203,618 D44E probably damaging Het
Acp5 T C 9: 22,127,083 I307M probably benign Het
Ahsa1 A G 12: 87,273,166 D245G possibly damaging Het
Ankrd40 A G 11: 94,339,633 K316E probably benign Het
Apol9b G A 15: 77,735,888 E295K possibly damaging Het
Aqp4 C A 18: 15,399,758 G93C probably damaging Het
Arhgap21 A G 2: 20,850,156 V1465A probably benign Het
Arhgap5 C T 12: 52,519,209 P988S possibly damaging Het
Asxl3 A C 18: 22,525,454 K2174Q probably damaging Het
Calm1 A G 12: 100,203,573 probably null Het
Ccdc33 C T 9: 58,067,535 V352M probably damaging Het
Ccdc88a G T 11: 29,460,907 K464N probably benign Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdc25b T A 2: 131,193,303 I327N probably damaging Het
Cenpf G A 1: 189,682,369 H184Y possibly damaging Het
Col6a5 G A 9: 105,934,298 T674I unknown Het
Creg2 A T 1: 39,623,190 M258K probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Cyp3a44 T A 5: 145,803,755 Y25F possibly damaging Het
Degs2 T A 12: 108,689,066 R283* probably null Het
Dido1 T C 2: 180,661,416 N1565S probably benign Het
Dnah6 A T 6: 73,022,424 M4008K probably benign Het
Dnmbp C A 19: 43,849,972 G1138V probably benign Het
Drosha A C 15: 12,914,047 H1136P probably damaging Het
Duox2 T G 2: 122,296,515 N173T probably damaging Het
Dync1li1 T G 9: 114,705,094 I87M probably benign Het
E2f8 A C 7: 48,867,746 S770A probably benign Het
Efemp1 A G 11: 28,926,241 T469A probably damaging Het
Eif3f A T 7: 108,937,775 T136S probably damaging Het
Enpp5 T C 17: 44,080,980 *46R probably null Het
Epb41l4b A G 4: 57,103,428 V136A probably damaging Het
Fam186a A C 15: 99,933,538 probably benign Het
Flt4 A G 11: 49,625,415 Y115C probably damaging Het
Gal T A 19: 3,411,126 probably null Het
Galnt3 C T 2: 66,093,539 V462I possibly damaging Het
Gas2l1 A G 11: 5,061,429 S467P possibly damaging Het
Gbx1 A G 5: 24,526,206 L204P probably damaging Het
Gle1 T A 2: 29,936,211 S101T probably benign Het
Gltpd2 A C 11: 70,519,477 Q87P probably damaging Het
Gm12789 T A 4: 101,988,882 D113E probably damaging Het
Gm1966 T A 7: 106,601,230 noncoding transcript Het
Grin3b G A 10: 79,976,898 G936R probably benign Het
Gtf3c2 C T 5: 31,174,090 probably null Het
Klhl28 T C 12: 64,957,269 T157A probably benign Het
Kmt2a A G 9: 44,821,466 probably benign Het
Lamp1 A G 8: 13,172,541 T242A probably benign Het
Lhfpl5 T G 17: 28,576,326 I109S possibly damaging Het
Lhfpl5 T A 17: 28,582,988 *220R probably null Het
Map4k2 C T 19: 6,344,429 T313I probably damaging Het
Matn2 A G 15: 34,423,799 D601G probably damaging Het
Mcur1 C T 13: 43,551,671 V170M possibly damaging Het
Mettl7a3 A T 15: 100,335,333 D135V probably damaging Het
Mphosph10 T C 7: 64,392,221 probably benign Het
Nat8l G A 5: 34,001,043 A266T probably benign Het
Nckap5 G T 1: 126,027,215 D469E possibly damaging Het
Nckap5l G T 15: 99,423,186 P1238T probably damaging Het
Ngf A G 3: 102,509,840 probably benign Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Odf3l2 G A 10: 79,640,017 P238S probably damaging Het
Olfr1396 A T 11: 49,113,621 V35D probably damaging Het
Olfr450 A G 6: 42,817,962 I164V possibly damaging Het
Pclo A T 5: 14,675,031 Y1301F unknown Het
Pclo A G 5: 14,713,125 T3871A unknown Het
Peli3 T C 19: 4,932,566 E357G probably damaging Het
Pkd1 T A 17: 24,565,374 probably null Het
Pla2g2c T G 4: 138,734,334 F38C probably damaging Het
Plekha2 T A 8: 25,059,944 T126S possibly damaging Het
Polr3f T A 2: 144,534,081 *142K probably null Het
Ppcs C T 4: 119,419,146 V81M probably benign Het
Prl7a1 A G 13: 27,635,764 I169T probably damaging Het
Rbm19 C A 5: 120,133,734 probably benign Het
Rdh7 T A 10: 127,885,762 Y215F probably benign Het
Rragd T G 4: 32,995,072 S62R probably benign Het
Rtel1 T C 2: 181,355,935 S1114P possibly damaging Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setbp1 A G 18: 78,858,800 S551P probably damaging Het
Setd6 T C 8: 95,717,055 probably benign Het
Slmap A C 14: 26,462,352 M292R probably damaging Het
Srrm4 T C 5: 116,477,134 D97G unknown Het
Stk-ps2 G A 1: 46,028,965 noncoding transcript Het
Syce1 A T 7: 140,778,423 M204K probably benign Het
Syk A G 13: 52,611,206 K123R probably benign Het
Tbc1d14 A T 5: 36,571,831 S64T probably damaging Het
Traf3ip3 T C 1: 193,184,829 K295E probably damaging Het
Trp53bp2 T C 1: 182,441,805 probably null Het
Tsc2 T A 17: 24,596,742 probably null Het
Tspyl4 T A 10: 34,297,738 C75* probably null Het
Uqcc2 T C 17: 27,125,159 I52V probably benign Het
Vcp T A 4: 42,983,486 T525S probably damaging Het
Vmn2r18 A T 5: 151,585,432 probably null Het
Vmp1 A G 11: 86,602,053 V310A probably benign Het
Vps13d T A 4: 145,069,165 R3671S probably damaging Het
Wdr3 T C 3: 100,146,545 T544A possibly damaging Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp541 T A 7: 16,090,382 F1010I probably damaging Het
Zfp64 T C 2: 168,926,112 T527A probably benign Het
Zyx G T 6: 42,356,487 R449M probably damaging Het
Other mutations in Brf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00928:Brf1 APN 12 112963600 splice site probably benign
IGL01609:Brf1 APN 12 112963591 missense probably damaging 1.00
IGL01610:Brf1 APN 12 112988083 missense probably benign
IGL01622:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01623:Brf1 APN 12 112961175 missense probably benign 0.02
IGL01791:Brf1 APN 12 112962475 missense probably benign 0.00
IGL02037:Brf1 APN 12 112993062 critical splice donor site probably null
IGL02227:Brf1 APN 12 112961774 missense probably damaging 1.00
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0106:Brf1 UTSW 12 112973463 unclassified probably benign
R0138:Brf1 UTSW 12 112961139 missense probably damaging 0.99
R1345:Brf1 UTSW 12 112961108 critical splice donor site probably null
R1370:Brf1 UTSW 12 112961108 critical splice donor site probably null
R1927:Brf1 UTSW 12 113000344 missense possibly damaging 0.95
R2423:Brf1 UTSW 12 113000199 missense probably benign 0.17
R3608:Brf1 UTSW 12 112961274 missense probably benign 0.00
R3703:Brf1 UTSW 12 112969371 splice site probably null
R4033:Brf1 UTSW 12 112979732 missense probably damaging 1.00
R4897:Brf1 UTSW 12 112965887 missense probably benign 0.05
R4985:Brf1 UTSW 12 112969370 splice site probably null
R5092:Brf1 UTSW 12 112979732 missense probably damaging 1.00
R7138:Brf1 UTSW 12 112970215 missense probably damaging 1.00
R7187:Brf1 UTSW 12 112960325 missense unknown
R7726:Brf1 UTSW 12 112964245 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTCCCAAAGCAGCTTCTCTG -3'
(R):5'- GCTGTCCCCTTATAGAAGCCAC -3'

Sequencing Primer
(F):5'- TCCAGTCTGTGAGGGGGAAC -3'
(R):5'- GTCCCCTTATAGAAGCCACAGCAG -3'
Posted On2016-02-04