Incidental Mutation 'R4817:Lhfpl5'
ID369955
Institutional Source Beutler Lab
Gene Symbol Lhfpl5
Ensembl Gene ENSMUSG00000062252
Gene Namelipoma HMGIC fusion partner-like 5
SynonymsTmhs, 9330179O15Rik
MMRRC Submission 042435-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R4817 (G1)
Quality Score98
Status Not validated
Chromosome17
Chromosomal Location28575718-28583593 bp(+) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) T to A at 28582988 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 220 (*220R)
Ref Sequence ENSEMBL: ENSMUSP00000079598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080780] [ENSMUST00000130643]
Predicted Effect probably null
Transcript: ENSMUST00000080780
AA Change: *220R
SMART Domains Protein: ENSMUSP00000079598
Gene: ENSMUSG00000062252
AA Change: *220R

DomainStartEndE-ValueType
Pfam:L_HGMIC_fpl 25 202 1.5e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130643
SMART Domains Protein: ENSMUSP00000116259
Gene: ENSMUSG00000004865

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
Pfam:Pkinase_Tyr 80 229 6.8e-11 PFAM
Pfam:Pkinase 80 231 5.6e-23 PFAM
low complexity region 241 255 N/A INTRINSIC
coiled coil region 264 297 N/A INTRINSIC
Pfam:Pkinase 468 646 3e-19 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (108/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the lipoma HMGIC fusion partner (LHFP) gene family, which is a subset of the superfamily of tetraspan transmembrane protein encoding genes. Mutations in this gene result in deafness in humans, and a mutation in a similar gene in mice results in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. It is proposed to function in hair bundle morphogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in deafness and vestibular dysfunction with severe degeneration of the organ of Corti. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 T A 2: 91,203,618 D44E probably damaging Het
Acp5 T C 9: 22,127,083 I307M probably benign Het
Ahsa1 A G 12: 87,273,166 D245G possibly damaging Het
Ankrd40 A G 11: 94,339,633 K316E probably benign Het
Apol9b G A 15: 77,735,888 E295K possibly damaging Het
Aqp4 C A 18: 15,399,758 G93C probably damaging Het
Arhgap21 A G 2: 20,850,156 V1465A probably benign Het
Arhgap5 C T 12: 52,519,209 P988S possibly damaging Het
Asxl3 A C 18: 22,525,454 K2174Q probably damaging Het
Brf1 A T 12: 112,972,301 I250N probably damaging Het
Calm1 A G 12: 100,203,573 probably null Het
Ccdc33 C T 9: 58,067,535 V352M probably damaging Het
Ccdc88a G T 11: 29,460,907 K464N probably benign Het
Cdadc1 AGACGGA AGA 14: 59,568,991 probably null Het
Cdc25b T A 2: 131,193,303 I327N probably damaging Het
Cenpf G A 1: 189,682,369 H184Y possibly damaging Het
Col6a5 G A 9: 105,934,298 T674I unknown Het
Creg2 A T 1: 39,623,190 M258K probably damaging Het
Csf3r T A 4: 126,037,656 Y477* probably null Het
Cyp3a44 T A 5: 145,803,755 Y25F possibly damaging Het
Degs2 T A 12: 108,689,066 R283* probably null Het
Dido1 T C 2: 180,661,416 N1565S probably benign Het
Dnah6 A T 6: 73,022,424 M4008K probably benign Het
Dnmbp C A 19: 43,849,972 G1138V probably benign Het
Drosha A C 15: 12,914,047 H1136P probably damaging Het
Duox2 T G 2: 122,296,515 N173T probably damaging Het
Dync1li1 T G 9: 114,705,094 I87M probably benign Het
E2f8 A C 7: 48,867,746 S770A probably benign Het
Efemp1 A G 11: 28,926,241 T469A probably damaging Het
Eif3f A T 7: 108,937,775 T136S probably damaging Het
Enpp5 T C 17: 44,080,980 *46R probably null Het
Epb41l4b A G 4: 57,103,428 V136A probably damaging Het
Fam186a A C 15: 99,933,538 probably benign Het
Flt4 A G 11: 49,625,415 Y115C probably damaging Het
Gal T A 19: 3,411,126 probably null Het
Galnt3 C T 2: 66,093,539 V462I possibly damaging Het
Gas2l1 A G 11: 5,061,429 S467P possibly damaging Het
Gbx1 A G 5: 24,526,206 L204P probably damaging Het
Gle1 T A 2: 29,936,211 S101T probably benign Het
Gltpd2 A C 11: 70,519,477 Q87P probably damaging Het
Gm12789 T A 4: 101,988,882 D113E probably damaging Het
Gm1966 T A 7: 106,601,230 noncoding transcript Het
Grin3b G A 10: 79,976,898 G936R probably benign Het
Gtf3c2 C T 5: 31,174,090 probably null Het
Klhl28 T C 12: 64,957,269 T157A probably benign Het
Kmt2a A G 9: 44,821,466 probably benign Het
Lamp1 A G 8: 13,172,541 T242A probably benign Het
Map4k2 C T 19: 6,344,429 T313I probably damaging Het
Matn2 A G 15: 34,423,799 D601G probably damaging Het
Mcur1 C T 13: 43,551,671 V170M possibly damaging Het
Mettl7a3 A T 15: 100,335,333 D135V probably damaging Het
Mphosph10 T C 7: 64,392,221 probably benign Het
Nat8l G A 5: 34,001,043 A266T probably benign Het
Nckap5 G T 1: 126,027,215 D469E possibly damaging Het
Nckap5l G T 15: 99,423,186 P1238T probably damaging Het
Ngf A G 3: 102,509,840 probably benign Het
Ntng1 T A 3: 109,934,868 L196F probably damaging Het
Odf3l2 G A 10: 79,640,017 P238S probably damaging Het
Olfr1396 A T 11: 49,113,621 V35D probably damaging Het
Olfr450 A G 6: 42,817,962 I164V possibly damaging Het
Pclo A T 5: 14,675,031 Y1301F unknown Het
Pclo A G 5: 14,713,125 T3871A unknown Het
Peli3 T C 19: 4,932,566 E357G probably damaging Het
Pkd1 T A 17: 24,565,374 probably null Het
Pla2g2c T G 4: 138,734,334 F38C probably damaging Het
Plekha2 T A 8: 25,059,944 T126S possibly damaging Het
Polr3f T A 2: 144,534,081 *142K probably null Het
Ppcs C T 4: 119,419,146 V81M probably benign Het
Prl7a1 A G 13: 27,635,764 I169T probably damaging Het
Rbm19 C A 5: 120,133,734 probably benign Het
Rdh7 T A 10: 127,885,762 Y215F probably benign Het
Rragd T G 4: 32,995,072 S62R probably benign Het
Rtel1 T C 2: 181,355,935 S1114P possibly damaging Het
Serpinb5 G T 1: 106,872,339 L86F probably damaging Het
Setbp1 A G 18: 78,858,800 S551P probably damaging Het
Setd6 T C 8: 95,717,055 probably benign Het
Slmap A C 14: 26,462,352 M292R probably damaging Het
Srrm4 T C 5: 116,477,134 D97G unknown Het
Stk-ps2 G A 1: 46,028,965 noncoding transcript Het
Syce1 A T 7: 140,778,423 M204K probably benign Het
Syk A G 13: 52,611,206 K123R probably benign Het
Tbc1d14 A T 5: 36,571,831 S64T probably damaging Het
Traf3ip3 T C 1: 193,184,829 K295E probably damaging Het
Trp53bp2 T C 1: 182,441,805 probably null Het
Tsc2 T A 17: 24,596,742 probably null Het
Tspyl4 T A 10: 34,297,738 C75* probably null Het
Uqcc2 T C 17: 27,125,159 I52V probably benign Het
Vcp T A 4: 42,983,486 T525S probably damaging Het
Vmn2r18 A T 5: 151,585,432 probably null Het
Vmp1 A G 11: 86,602,053 V310A probably benign Het
Vps13d T A 4: 145,069,165 R3671S probably damaging Het
Wdr3 T C 3: 100,146,545 T544A possibly damaging Het
Zc3h14 C G 12: 98,752,848 D157E probably damaging Het
Zfp541 T A 7: 16,090,382 F1010I probably damaging Het
Zfp64 T C 2: 168,926,112 T527A probably benign Het
Zyx G T 6: 42,356,487 R449M probably damaging Het
Other mutations in Lhfpl5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Lhfpl5 APN 17 28576175 missense possibly damaging 0.49
R0885:Lhfpl5 UTSW 17 28576037 missense probably damaging 1.00
R3176:Lhfpl5 UTSW 17 28579946 missense possibly damaging 0.87
R3276:Lhfpl5 UTSW 17 28579946 missense possibly damaging 0.87
R4747:Lhfpl5 UTSW 17 28579976 missense probably damaging 1.00
R4817:Lhfpl5 UTSW 17 28576326 missense possibly damaging 0.93
R5148:Lhfpl5 UTSW 17 28579968 missense probably damaging 1.00
R5447:Lhfpl5 UTSW 17 28576097 missense probably damaging 1.00
R7024:Lhfpl5 UTSW 17 28582983 missense probably benign 0.15
R7605:Lhfpl5 UTSW 17 28576331 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CAGCCAAAGATGCAGCGATC -3'
(R):5'- AGCATTATTGATTTGTCCCCATCCG -3'

Sequencing Primer
(F):5'- GATGCAGCGATCTTCTAGAAAGTC -3'
(R):5'- AGGTCACAAACAGCTCTG -3'
Posted On2016-02-04