Incidental Mutation 'R4818:Nfasc'
ID369968
Institutional Source Beutler Lab
Gene Symbol Nfasc
Ensembl Gene ENSMUSG00000026442
Gene Nameneurofascin
SynonymsD430023G06Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4818 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132564690-132741797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 132603830 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 739 (T739A)
Ref Sequence ENSEMBL: ENSMUSP00000139955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043189] [ENSMUST00000094569] [ENSMUST00000163770] [ENSMUST00000187861] [ENSMUST00000188307]
Predicted Effect probably benign
Transcript: ENSMUST00000043189
AA Change: T718A

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000035454
Gene: ENSMUSG00000026442
AA Change: T718A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 253 317 1.53e-17 SMART
IGc2 343 409 1.76e-8 SMART
IGc2 437 502 2.39e-10 SMART
IGc2 528 593 2.54e-5 SMART
FN3 607 690 2.17e-11 SMART
FN3 707 789 2.85e-6 SMART
FN3 805 896 2.21e-3 SMART
FN3 911 995 9.92e-6 SMART
low complexity region 996 1018 N/A INTRINSIC
transmembrane domain 1026 1048 N/A INTRINSIC
Pfam:Bravo_FIGEY 1049 1133 1.4e-29 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000094569
AA Change: T739A

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092148
Gene: ENSMUSG00000026442
AA Change: T739A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 4.5e0 SMART
IG 147 234 2.44e-7 SMART
IGc2 259 323 1.53e-17 SMART
IGc2 349 415 1.76e-8 SMART
IGc2 443 508 2.39e-10 SMART
IGc2 534 599 2.54e-5 SMART
FN3 628 711 2.17e-11 SMART
FN3 728 810 2.85e-6 SMART
FN3 825 909 9.92e-6 SMART
FN3 1010 1086 6.91e-5 SMART
transmembrane domain 1109 1131 N/A INTRINSIC
Pfam:Bravo_FIGEY 1132 1216 2.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163770
AA Change: T735A

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132979
Gene: ENSMUSG00000026442
AA Change: T735A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 4.5e0 SMART
IG 141 228 2.44e-7 SMART
IGc2 270 334 1.53e-17 SMART
IGc2 360 426 1.76e-8 SMART
IGc2 454 519 2.39e-10 SMART
IGc2 545 610 2.54e-5 SMART
FN3 624 707 2.17e-11 SMART
FN3 724 806 2.85e-6 SMART
FN3 822 913 2.21e-3 SMART
FN3 928 1012 9.92e-6 SMART
low complexity region 1013 1035 N/A INTRINSIC
transmembrane domain 1043 1065 N/A INTRINSIC
Pfam:Bravo_FIGEY 1066 1150 5e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186389
AA Change: T719A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186539
Predicted Effect possibly damaging
Transcript: ENSMUST00000187861
AA Change: T739A

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139955
Gene: ENSMUSG00000026442
AA Change: T739A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 48 137 1.8e-2 SMART
IG 147 234 1e-9 SMART
IGc2 259 323 6.4e-20 SMART
IGc2 349 415 7e-11 SMART
IGc2 443 508 9.7e-13 SMART
IGc2 534 599 1.1e-7 SMART
FN3 628 711 1e-13 SMART
FN3 728 810 1.4e-8 SMART
FN3 826 917 1.1e-5 SMART
FN3 932 1016 4.8e-8 SMART
FN3 1117 1193 3.4e-7 SMART
transmembrane domain 1216 1238 N/A INTRINSIC
Pfam:Bravo_FIGEY 1239 1325 2.6e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188307
AA Change: T733A

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000139520
Gene: ENSMUSG00000026442
AA Change: T733A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 42 131 1.8e-2 SMART
IG 141 228 1e-9 SMART
IGc2 253 317 6.4e-20 SMART
IGc2 343 409 7e-11 SMART
IGc2 437 502 9.7e-13 SMART
IGc2 528 593 1.1e-7 SMART
FN3 622 705 1e-13 SMART
FN3 722 804 1.4e-8 SMART
FN3 820 890 3.8e-1 SMART
Meta Mutation Damage Score 0.1177 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: This gene encodes an L1 family immunoglobulin cell adhesion molecule with multiple IGcam and fibronectin domains. The protein functions in neurite outgrowth, neurite fasciculation, and organization of the axon initial segment (AIS) and nodes of Ranvier on axons during early development. Both the AIS and nodes of Ranvier contain high densities of voltage-gated Na+ (Nav) channels which are clustered by interactions with cytoskeletal and scaffolding proteins including this protein, gliomedin, ankyrin 3 (ankyrin-G), and betaIV spectrin. This protein links the AIS extracellular matrix to the intracellular cytoskeleton. This gene undergoes extensive alternative splicing, and the full-length nature of some variants has not been determined. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for a null allele die within 6 to 7 days of birth, exhibit reduced nerve conduction velocity and abnormal paranodal junction formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,741,466 E562G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
A930033H14Rik A T 10: 69,212,360 probably benign Het
Abca17 C T 17: 24,317,161 E511K probably damaging Het
Abca9 C T 11: 110,155,154 probably null Het
Abhd5 T A 9: 122,363,800 probably null Het
Adra2b G A 2: 127,364,092 W171* probably null Het
Aldh1l1 T C 6: 90,596,915 Y799H probably benign Het
Arfgef1 A G 1: 10,216,547 V46A probably benign Het
Arhgap40 A G 2: 158,539,719 E374G probably damaging Het
Arhgef5 G A 6: 43,273,550 V412I probably benign Het
Arid3c T C 4: 41,730,072 E41G possibly damaging Het
Atp8b4 T A 2: 126,322,816 K1193N probably benign Het
C4a C T 17: 34,816,999 noncoding transcript Het
Chst2 C T 9: 95,405,364 D310N probably damaging Het
Crtc3 T C 7: 80,677,422 Q52R possibly damaging Het
Crybg1 T C 10: 43,998,587 I842V probably benign Het
Dennd4c T C 4: 86,825,274 S1167P probably benign Het
Edem3 T C 1: 151,792,385 V305A possibly damaging Het
Epha10 T A 4: 124,886,214 probably null Het
Epha6 C A 16: 59,654,063 R1117L probably damaging Het
Fdx1l T C 9: 21,067,864 I144V possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm14139 T A 2: 150,192,061 C132S probably damaging Het
Gm4737 G A 16: 46,154,192 T274I probably damaging Het
Hus1 A G 11: 8,996,808 probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Inpp5f A G 7: 128,685,129 I577M probably damaging Het
Kansl2 G A 15: 98,526,661 T296I possibly damaging Het
Kcna6 A G 6: 126,738,424 F501L probably benign Het
Kirrel2 A T 7: 30,449,868 V579D probably benign Het
Larp1b T C 3: 40,970,570 Y208H probably damaging Het
Lipf A T 19: 33,965,688 D132V probably benign Het
Lsm12 T C 11: 102,167,163 K40E probably damaging Het
Mastl A G 2: 23,137,026 S275P probably benign Het
Mrpl44 A G 1: 79,780,977 I281V probably benign Het
Mtf1 T A 4: 124,804,712 M1K probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh2 G A 11: 67,176,255 G179R probably damaging Het
Nfatc3 G A 8: 106,108,379 V778I probably benign Het
Notch4 A G 17: 34,578,716 probably benign Het
Npm2 T C 14: 70,652,402 N24S probably benign Het
Obox7 T A 7: 14,664,485 L108Q probably damaging Het
Olfr615 T A 7: 103,560,761 F95I probably benign Het
Pax3 A G 1: 78,132,232 V263A probably damaging Het
Pdlim1 C T 19: 40,223,136 V238I probably damaging Het
Pik3ip1 G A 11: 3,330,928 probably benign Het
Ptprq A G 10: 107,710,581 V284A possibly damaging Het
Rad9b G A 5: 122,339,776 T179I probably damaging Het
Rrnad1 C A 3: 87,924,998 R293L probably benign Het
Sirt4 G T 5: 115,479,726 D290E possibly damaging Het
Skint6 T A 4: 112,955,392 probably benign Het
Slc18a1 A C 8: 69,040,299 I466S probably damaging Het
Slc35e4 C T 11: 3,912,889 R100H probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Tas1r1 C G 4: 152,032,674 V168L probably benign Het
Tmem233 T A 5: 116,083,163 Q8L possibly damaging Het
Ttc17 G T 2: 94,332,891 Q862K possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp229 T C 17: 21,743,904 I68T probably benign Het
Zfp423 A G 8: 87,904,500 V30A probably benign Het
Other mutations in Nfasc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Nfasc APN 1 132573798 nonsense probably null
IGL01088:Nfasc APN 1 132642776 utr 5 prime probably benign
IGL01958:Nfasc APN 1 132608438 nonsense probably null
IGL01999:Nfasc APN 1 132605247 splice site probably benign
IGL02170:Nfasc APN 1 132610366 nonsense probably null
IGL02187:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02192:Nfasc APN 1 132570481 missense probably damaging 1.00
IGL02452:Nfasc APN 1 132620924 critical splice donor site probably null
IGL02698:Nfasc APN 1 132634737 missense probably benign 0.06
IGL02797:Nfasc APN 1 132610448 missense probably damaging 1.00
IGL03000:Nfasc APN 1 132621509 splice site probably benign
IGL03027:Nfasc APN 1 132610469 missense probably damaging 1.00
jiggle UTSW 1 132602021 missense probably damaging 1.00
R7838_nfasc_079 UTSW 1 132605549 missense probably damaging 1.00
Tremble UTSW 1 132611595 missense probably damaging 1.00
PIT4377001:Nfasc UTSW 1 132583066 missense unknown
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0240:Nfasc UTSW 1 132601983 missense probably damaging 1.00
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0241:Nfasc UTSW 1 132636993 missense probably benign 0.02
R0418:Nfasc UTSW 1 132611595 missense probably damaging 1.00
R0513:Nfasc UTSW 1 132603846 missense possibly damaging 0.95
R0639:Nfasc UTSW 1 132603816 missense probably damaging 1.00
R0646:Nfasc UTSW 1 132608438 nonsense probably null
R1103:Nfasc UTSW 1 132607057 splice site probably benign
R1269:Nfasc UTSW 1 132610788 missense probably damaging 1.00
R1550:Nfasc UTSW 1 132608503 missense probably damaging 0.96
R1749:Nfasc UTSW 1 132611632 missense probably damaging 1.00
R1773:Nfasc UTSW 1 132610839 missense probably damaging 1.00
R1921:Nfasc UTSW 1 132610805 missense probably damaging 1.00
R1987:Nfasc UTSW 1 132610886 missense probably damaging 1.00
R2141:Nfasc UTSW 1 132596645 missense probably damaging 1.00
R2239:Nfasc UTSW 1 132583022 intron probably benign
R2413:Nfasc UTSW 1 132595505 missense probably damaging 1.00
R2428:Nfasc UTSW 1 132595654 missense possibly damaging 0.55
R2472:Nfasc UTSW 1 132588221 intron probably benign
R2517:Nfasc UTSW 1 132597763 splice site probably null
R3850:Nfasc UTSW 1 132631733 missense probably damaging 1.00
R4050:Nfasc UTSW 1 132610305 splice site probably benign
R4061:Nfasc UTSW 1 132597845 missense probably damaging 1.00
R4088:Nfasc UTSW 1 132595591 missense probably damaging 1.00
R4342:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4343:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4345:Nfasc UTSW 1 132631705 missense probably damaging 1.00
R4452:Nfasc UTSW 1 132634671 missense probably damaging 1.00
R4851:Nfasc UTSW 1 132602021 missense probably damaging 1.00
R5014:Nfasc UTSW 1 132584447 intron probably benign
R5768:Nfasc UTSW 1 132605145 missense probably benign 0.00
R6145:Nfasc UTSW 1 132634717 missense probably damaging 1.00
R6335:Nfasc UTSW 1 132576394 missense probably damaging 0.98
R6379:Nfasc UTSW 1 132570542 nonsense probably null
R6486:Nfasc UTSW 1 132605214 missense probably damaging 1.00
R7022:Nfasc UTSW 1 132621049 missense probably damaging 1.00
R7062:Nfasc UTSW 1 132601969 critical splice donor site probably null
R7084:Nfasc UTSW 1 132570509 missense unknown
R7275:Nfasc UTSW 1 132634263 missense probably damaging 1.00
R7286:Nfasc UTSW 1 132602052 missense probably damaging 1.00
R7682:Nfasc UTSW 1 132573773 missense unknown
R7838:Nfasc UTSW 1 132605549 missense probably damaging 1.00
R7871:Nfasc UTSW 1 132600013 missense not run
R7938:Nfasc UTSW 1 132605531 missense probably damaging 1.00
R8083:Nfasc UTSW 1 132596582 missense probably benign 0.00
R8482:Nfasc UTSW 1 132605089 missense probably damaging 1.00
Z1176:Nfasc UTSW 1 132634638 missense probably benign 0.00
Z1177:Nfasc UTSW 1 132631838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAGTGGTCCCAGTTAGAC -3'
(R):5'- CTTAGCCAGGAAGACAGAGCAC -3'

Sequencing Primer
(F):5'- CTTTCACAGGGGTCACATATCAG -3'
(R):5'- CAGGAAGACAGAGCACACACG -3'
Posted On2016-02-04