Incidental Mutation 'R4818:Mastl'
ID 369970
Institutional Source Beutler Lab
Gene Symbol Mastl
Ensembl Gene ENSMUSG00000026779
Gene Name microtubule associated serine/threonine kinase-like
Synonyms THC2, 2700091H24Rik
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4818 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 23006549-23046036 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23027038 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 275 (S275P)
Ref Sequence ENSEMBL: ENSMUSP00000028119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028119]
AlphaFold Q8C0P0
Predicted Effect probably benign
Transcript: ENSMUST00000028119
AA Change: S275P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028119
Gene: ENSMUSG00000026779
AA Change: S275P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
Pfam:Pkinase_Tyr 34 194 2.6e-24 PFAM
Pfam:Pkinase 34 200 2.3e-39 PFAM
low complexity region 297 313 N/A INTRINSIC
Pfam:Pkinase 710 821 6.4e-19 PFAM
Pfam:Pkinase_Tyr 714 818 5.1e-6 PFAM
S_TK_X 822 864 2.01e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136207
Meta Mutation Damage Score 0.0652 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a microtubule-associated serine/threonine kinase. Mutations at this locus have been associated with autosomal dominant thrombocytopenia, also known as thrombocytopenia-2. Alternatively spliced transcript variants have been described for this locus. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality and mitotic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,571,810 (GRCm39) E562G probably benign Het
5730522E02Rik A G 11: 25,720,472 (GRCm39) probably null Het
A930033H14Rik A T 10: 69,048,190 (GRCm39) probably benign Het
Abca17 C T 17: 24,536,135 (GRCm39) E511K probably damaging Het
Abca9 C T 11: 110,045,980 (GRCm39) probably null Het
Abhd5 T A 9: 122,192,865 (GRCm39) probably null Het
Adra2b G A 2: 127,206,012 (GRCm39) W171* probably null Het
Ahcyl G A 16: 45,974,555 (GRCm39) T274I probably damaging Het
Aldh1l1 T C 6: 90,573,897 (GRCm39) Y799H probably benign Het
Arfgef1 A G 1: 10,286,772 (GRCm39) V46A probably benign Het
Arhgap40 A G 2: 158,381,639 (GRCm39) E374G probably damaging Het
Arhgef5 G A 6: 43,250,484 (GRCm39) V412I probably benign Het
Arid3c T C 4: 41,730,072 (GRCm39) E41G possibly damaging Het
Atp8b4 T A 2: 126,164,736 (GRCm39) K1193N probably benign Het
C4a C T 17: 35,035,975 (GRCm39) noncoding transcript Het
Chst2 C T 9: 95,287,417 (GRCm39) D310N probably damaging Het
Crtc3 T C 7: 80,327,170 (GRCm39) Q52R possibly damaging Het
Crybg1 T C 10: 43,874,583 (GRCm39) I842V probably benign Het
Dennd4c T C 4: 86,743,511 (GRCm39) S1167P probably benign Het
Edem3 T C 1: 151,668,136 (GRCm39) V305A possibly damaging Het
Epha10 T A 4: 124,780,007 (GRCm39) probably null Het
Epha6 C A 16: 59,474,426 (GRCm39) R1117L probably damaging Het
Fdx2 T C 9: 20,979,160 (GRCm39) I144V possibly damaging Het
Gm10762 C T 2: 128,809,106 (GRCm39) W81* probably null Het
Hus1 A G 11: 8,946,808 (GRCm39) probably benign Het
Igbp1b C T 6: 138,634,803 (GRCm39) E214K probably benign Het
Inpp5f A G 7: 128,286,853 (GRCm39) I577M probably damaging Het
Kansl2 G A 15: 98,424,542 (GRCm39) T296I possibly damaging Het
Kcna6 A G 6: 126,715,387 (GRCm39) F501L probably benign Het
Kirrel2 A T 7: 30,149,293 (GRCm39) V579D probably benign Het
Larp1b T C 3: 40,925,005 (GRCm39) Y208H probably damaging Het
Lipf A T 19: 33,943,088 (GRCm39) D132V probably benign Het
Lsm12 T C 11: 102,057,989 (GRCm39) K40E probably damaging Het
Mettl25b C A 3: 87,832,305 (GRCm39) R293L probably benign Het
Mrpl44 A G 1: 79,758,694 (GRCm39) I281V probably benign Het
Mtf1 T A 4: 124,698,505 (GRCm39) M1K probably null Het
Muc4 G C 16: 32,753,919 (GRCm38) R1265P probably benign Het
Myh2 G A 11: 67,067,081 (GRCm39) G179R probably damaging Het
Nfasc T C 1: 132,531,568 (GRCm39) T739A possibly damaging Het
Nfatc3 G A 8: 106,835,011 (GRCm39) V778I probably benign Het
Notch4 A G 17: 34,797,690 (GRCm39) probably benign Het
Npm2 T C 14: 70,889,842 (GRCm39) N24S probably benign Het
Obox7 T A 7: 14,398,410 (GRCm39) L108Q probably damaging Het
Or51ah3 T A 7: 103,209,968 (GRCm39) F95I probably benign Het
Pax3 A G 1: 78,108,869 (GRCm39) V263A probably damaging Het
Pdlim1 C T 19: 40,211,580 (GRCm39) V238I probably damaging Het
Pik3ip1 G A 11: 3,280,928 (GRCm39) probably benign Het
Ptprq A G 10: 107,546,442 (GRCm39) V284A possibly damaging Het
Rad9b G A 5: 122,477,839 (GRCm39) T179I probably damaging Het
Sirt4 G T 5: 115,617,785 (GRCm39) D290E possibly damaging Het
Skint6 T A 4: 112,812,589 (GRCm39) probably benign Het
Slc18a1 A C 8: 69,492,951 (GRCm39) I466S probably damaging Het
Slc35e4 C T 11: 3,862,889 (GRCm39) R100H probably benign Het
Sptbn5 T G 2: 119,898,449 (GRCm39) K470Q probably benign Het
Tas1r1 C G 4: 152,117,131 (GRCm39) V168L probably benign Het
Tmem233 T A 5: 116,221,222 (GRCm39) Q8L possibly damaging Het
Ttc17 G T 2: 94,163,236 (GRCm39) Q862K possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 106,210,376 (GRCm39) probably null Het
Zfp1004 T A 2: 150,033,981 (GRCm39) C132S probably damaging Het
Zfp229 T C 17: 21,962,885 (GRCm39) I68T probably benign Het
Zfp423 A G 8: 88,631,128 (GRCm39) V30A probably benign Het
Other mutations in Mastl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Mastl APN 2 23,036,160 (GRCm39) missense probably damaging 1.00
IGL02103:Mastl APN 2 23,030,010 (GRCm39) missense probably benign 0.01
IGL02622:Mastl APN 2 23,022,857 (GRCm39) missense probably benign 0.12
IGL02826:Mastl APN 2 23,035,421 (GRCm39) missense probably damaging 1.00
IGL02896:Mastl APN 2 23,021,779 (GRCm39) missense probably damaging 1.00
IGL03024:Mastl APN 2 23,029,931 (GRCm39) missense probably damaging 1.00
IGL03038:Mastl APN 2 23,030,627 (GRCm39) splice site probably benign
R0600:Mastl UTSW 2 23,023,358 (GRCm39) missense probably benign 0.06
R0712:Mastl UTSW 2 23,041,005 (GRCm39) missense probably damaging 1.00
R1168:Mastl UTSW 2 23,023,144 (GRCm39) missense probably benign 0.06
R1750:Mastl UTSW 2 23,036,093 (GRCm39) nonsense probably null
R1911:Mastl UTSW 2 23,022,692 (GRCm39) nonsense probably null
R2051:Mastl UTSW 2 23,022,836 (GRCm39) missense possibly damaging 0.49
R2859:Mastl UTSW 2 23,029,979 (GRCm39) missense probably damaging 0.99
R3799:Mastl UTSW 2 23,030,504 (GRCm39) splice site probably benign
R3840:Mastl UTSW 2 23,030,563 (GRCm39) missense probably damaging 1.00
R4807:Mastl UTSW 2 23,022,855 (GRCm39) missense probably benign
R4845:Mastl UTSW 2 23,030,010 (GRCm39) missense probably benign 0.01
R5338:Mastl UTSW 2 23,023,503 (GRCm39) missense probably benign 0.01
R5364:Mastl UTSW 2 23,023,665 (GRCm39) missense probably benign 0.16
R6077:Mastl UTSW 2 23,045,806 (GRCm39) missense probably damaging 0.99
R6158:Mastl UTSW 2 23,022,784 (GRCm39) missense possibly damaging 0.92
R6450:Mastl UTSW 2 23,010,941 (GRCm39) missense probably damaging 1.00
R6602:Mastl UTSW 2 23,022,689 (GRCm39) missense probably benign 0.04
R6788:Mastl UTSW 2 23,023,710 (GRCm39) missense probably benign 0.22
R6908:Mastl UTSW 2 23,045,988 (GRCm39) start gained probably benign
R7058:Mastl UTSW 2 23,023,425 (GRCm39) nonsense probably null
R7233:Mastl UTSW 2 23,023,670 (GRCm39) missense probably benign
R7249:Mastl UTSW 2 23,036,151 (GRCm39) missense probably damaging 1.00
R7347:Mastl UTSW 2 23,023,401 (GRCm39) missense probably damaging 0.99
R7371:Mastl UTSW 2 23,030,585 (GRCm39) missense probably damaging 1.00
R7726:Mastl UTSW 2 23,030,807 (GRCm39) splice site probably null
R8057:Mastl UTSW 2 23,023,566 (GRCm39) missense possibly damaging 0.75
R8288:Mastl UTSW 2 23,023,371 (GRCm39) missense probably damaging 1.00
R9101:Mastl UTSW 2 23,008,449 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- ATGTATACTTCCTCCTAACCTGGCAG -3'
(R):5'- TTATGACCTTCAAAGTACTGCCTAC -3'

Sequencing Primer
(F):5'- GGCAGTCTCTTTCCCATTTGG -3'
(R):5'- TGGAAAGAGTCAAGTCCC -3'
Posted On 2016-02-04