Incidental Mutation 'R4818:Atp8b4'
ID369975
Institutional Source Beutler Lab
Gene Symbol Atp8b4
Ensembl Gene ENSMUSG00000060131
Gene NameATPase, class I, type 8B, member 4
SynonymsIm
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4818 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126320973-126500674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 126322816 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 1193 (K1193N)
Ref Sequence ENSEMBL: ENSMUSP00000047302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040128] [ENSMUST00000040149]
Predicted Effect probably benign
Transcript: ENSMUST00000040128
AA Change: K1193N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000046444
Gene: ENSMUSG00000060131
AA Change: K1193N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000040149
AA Change: K1193N

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000047302
Gene: ENSMUSG00000060131
AA Change: K1193N

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 15 81 3.4e-30 PFAM
Pfam:E1-E2_ATPase 81 352 5.1e-8 PFAM
Pfam:HAD 390 826 1.1e-18 PFAM
Pfam:Cation_ATPase 474 573 5.5e-10 PFAM
Pfam:PhoLip_ATPase_C 843 1097 1.6e-83 PFAM
low complexity region 1113 1130 N/A INTRINSIC
Meta Mutation Damage Score 0.0604 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cation transport ATPase (P-type) family and type IV subfamily. The encoded protein is involved in phospholipid transport in the cell membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,741,466 E562G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
A930033H14Rik A T 10: 69,212,360 probably benign Het
Abca17 C T 17: 24,317,161 E511K probably damaging Het
Abca9 C T 11: 110,155,154 probably null Het
Abhd5 T A 9: 122,363,800 probably null Het
Adra2b G A 2: 127,364,092 W171* probably null Het
Aldh1l1 T C 6: 90,596,915 Y799H probably benign Het
Arfgef1 A G 1: 10,216,547 V46A probably benign Het
Arhgap40 A G 2: 158,539,719 E374G probably damaging Het
Arhgef5 G A 6: 43,273,550 V412I probably benign Het
Arid3c T C 4: 41,730,072 E41G possibly damaging Het
C4a C T 17: 34,816,999 noncoding transcript Het
Chst2 C T 9: 95,405,364 D310N probably damaging Het
Crtc3 T C 7: 80,677,422 Q52R possibly damaging Het
Crybg1 T C 10: 43,998,587 I842V probably benign Het
Dennd4c T C 4: 86,825,274 S1167P probably benign Het
Edem3 T C 1: 151,792,385 V305A possibly damaging Het
Epha10 T A 4: 124,886,214 probably null Het
Epha6 C A 16: 59,654,063 R1117L probably damaging Het
Fdx1l T C 9: 21,067,864 I144V possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm14139 T A 2: 150,192,061 C132S probably damaging Het
Gm4737 G A 16: 46,154,192 T274I probably damaging Het
Hus1 A G 11: 8,996,808 probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Inpp5f A G 7: 128,685,129 I577M probably damaging Het
Kansl2 G A 15: 98,526,661 T296I possibly damaging Het
Kcna6 A G 6: 126,738,424 F501L probably benign Het
Kirrel2 A T 7: 30,449,868 V579D probably benign Het
Larp1b T C 3: 40,970,570 Y208H probably damaging Het
Lipf A T 19: 33,965,688 D132V probably benign Het
Lsm12 T C 11: 102,167,163 K40E probably damaging Het
Mastl A G 2: 23,137,026 S275P probably benign Het
Mrpl44 A G 1: 79,780,977 I281V probably benign Het
Mtf1 T A 4: 124,804,712 M1K probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh2 G A 11: 67,176,255 G179R probably damaging Het
Nfasc T C 1: 132,603,830 T739A possibly damaging Het
Nfatc3 G A 8: 106,108,379 V778I probably benign Het
Notch4 A G 17: 34,578,716 probably benign Het
Npm2 T C 14: 70,652,402 N24S probably benign Het
Obox7 T A 7: 14,664,485 L108Q probably damaging Het
Olfr615 T A 7: 103,560,761 F95I probably benign Het
Pax3 A G 1: 78,132,232 V263A probably damaging Het
Pdlim1 C T 19: 40,223,136 V238I probably damaging Het
Pik3ip1 G A 11: 3,330,928 probably benign Het
Ptprq A G 10: 107,710,581 V284A possibly damaging Het
Rad9b G A 5: 122,339,776 T179I probably damaging Het
Rrnad1 C A 3: 87,924,998 R293L probably benign Het
Sirt4 G T 5: 115,479,726 D290E possibly damaging Het
Skint6 T A 4: 112,955,392 probably benign Het
Slc18a1 A C 8: 69,040,299 I466S probably damaging Het
Slc35e4 C T 11: 3,912,889 R100H probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Tas1r1 C G 4: 152,032,674 V168L probably benign Het
Tmem233 T A 5: 116,083,163 Q8L possibly damaging Het
Ttc17 G T 2: 94,332,891 Q862K possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp229 T C 17: 21,743,904 I68T probably benign Het
Zfp423 A G 8: 87,904,500 V30A probably benign Het
Other mutations in Atp8b4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Atp8b4 APN 2 126358897 missense probably damaging 1.00
IGL00841:Atp8b4 APN 2 126383769 missense probably damaging 0.97
IGL00917:Atp8b4 APN 2 126374533 missense probably benign 0.00
IGL01013:Atp8b4 APN 2 126323087 missense probably benign 0.25
IGL01374:Atp8b4 APN 2 126383657 splice site probably benign
IGL01898:Atp8b4 APN 2 126389361 missense probably benign 0.00
IGL01927:Atp8b4 APN 2 126322976 missense probably damaging 0.99
IGL01971:Atp8b4 APN 2 126462616 missense probably benign 0.05
R0320:Atp8b4 UTSW 2 126459694 missense possibly damaging 0.55
R0441:Atp8b4 UTSW 2 126378706 splice site probably benign
R0526:Atp8b4 UTSW 2 126427363 missense probably damaging 1.00
R0765:Atp8b4 UTSW 2 126372150 splice site probably null
R0964:Atp8b4 UTSW 2 126337493 missense probably damaging 1.00
R1386:Atp8b4 UTSW 2 126378744 missense probably benign 0.00
R1401:Atp8b4 UTSW 2 126323093 critical splice acceptor site probably null
R1568:Atp8b4 UTSW 2 126325394 missense probably benign
R1792:Atp8b4 UTSW 2 126325294 missense probably benign
R1830:Atp8b4 UTSW 2 126403381 missense probably benign 0.03
R1839:Atp8b4 UTSW 2 126361782 missense possibly damaging 0.92
R1984:Atp8b4 UTSW 2 126323008 missense probably damaging 1.00
R2143:Atp8b4 UTSW 2 126374510 missense probably damaging 1.00
R2186:Atp8b4 UTSW 2 126358860 missense probably damaging 1.00
R2212:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R2473:Atp8b4 UTSW 2 126358894 missense possibly damaging 0.67
R3412:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R3414:Atp8b4 UTSW 2 126375757 missense probably damaging 1.00
R4519:Atp8b4 UTSW 2 126414459 splice site probably null
R4543:Atp8b4 UTSW 2 126358066 missense probably damaging 0.97
R4701:Atp8b4 UTSW 2 126414293 missense probably damaging 1.00
R4895:Atp8b4 UTSW 2 126414369 missense probably benign 0.23
R5213:Atp8b4 UTSW 2 126389409 splice site probably null
R5239:Atp8b4 UTSW 2 126392861 splice site probably null
R5241:Atp8b4 UTSW 2 126383726 missense probably benign
R5654:Atp8b4 UTSW 2 126375805 missense probably damaging 1.00
R5725:Atp8b4 UTSW 2 126433936 missense probably benign
R5771:Atp8b4 UTSW 2 126378744 missense probably benign 0.11
R5949:Atp8b4 UTSW 2 126405322 missense probably benign 0.02
R5993:Atp8b4 UTSW 2 126403234 missense probably benign
R5998:Atp8b4 UTSW 2 126433867 splice site probably null
R6550:Atp8b4 UTSW 2 126424193 missense probably damaging 1.00
R6575:Atp8b4 UTSW 2 126414364 missense probably damaging 1.00
R6892:Atp8b4 UTSW 2 126343002 missense possibly damaging 0.94
R6915:Atp8b4 UTSW 2 126358914 nonsense probably null
R7045:Atp8b4 UTSW 2 126372195 missense probably benign 0.00
R7206:Atp8b4 UTSW 2 126458292 missense probably damaging 0.99
R7349:Atp8b4 UTSW 2 126325345 missense probably benign 0.00
R7395:Atp8b4 UTSW 2 126375694 missense possibly damaging 0.76
R7429:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7430:Atp8b4 UTSW 2 126403371 missense possibly damaging 0.47
R7548:Atp8b4 UTSW 2 126389342 missense probably benign
R7724:Atp8b4 UTSW 2 126322893 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATTGGACAGTGCCCATCTGG -3'
(R):5'- CAGGTCGAGCTCTAGAAGATCTGG -3'

Sequencing Primer
(F):5'- ATCTGGCCTGGAATCCTGCAG -3'
(R):5'- GCTCTAGAAGATCTGGATACGC -3'
Posted On2016-02-04