Incidental Mutation 'R4818:Hus1'
ID370012
Institutional Source Beutler Lab
Gene Symbol Hus1
Ensembl Gene ENSMUSG00000020413
Gene NameHUS1 checkpoint clamp component
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4818 (G1)
Quality Score220
Status Validated
Chromosome11
Chromosomal Location8993137-9011191 bp(-) (GRCm38)
Type of Mutationutr 3 prime
DNA Base Change (assembly) A to G at 8996808 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020683] [ENSMUST00000129115]
Predicted Effect probably benign
Transcript: ENSMUST00000020683
SMART Domains Protein: ENSMUSP00000020683
Gene: ENSMUSG00000020413

DomainStartEndE-ValueType
Pfam:Hus1 1 280 5.1e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129115
SMART Domains Protein: ENSMUSP00000114339
Gene: ENSMUSG00000020413

DomainStartEndE-ValueType
Pfam:Hus1 1 280 4.8e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139877
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146002
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152890
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: This gene encodes a component of a cell cycle checkpoint complex that causes cell cycle arrest in response to bulky DNA lesions and DNA replication blockage. Together with the proteins Rad9 and Rad1, the encoded protein forms a heterotrimeric complex known as the 9-1-1 complex. Mice lacking the encoded protein develop spontaneous chromosomal abnormalities resulting in embryonic lethality. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects in yolk sac vascularization, placental abnormalities, extensive apoptosis, and midgestational lethality. Mutant cells show increased chromosomal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,741,466 E562G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
A930033H14Rik A T 10: 69,212,360 probably benign Het
Abca17 C T 17: 24,317,161 E511K probably damaging Het
Abca9 C T 11: 110,155,154 probably null Het
Abhd5 T A 9: 122,363,800 probably null Het
Adra2b G A 2: 127,364,092 W171* probably null Het
Aldh1l1 T C 6: 90,596,915 Y799H probably benign Het
Arfgef1 A G 1: 10,216,547 V46A probably benign Het
Arhgap40 A G 2: 158,539,719 E374G probably damaging Het
Arhgef5 G A 6: 43,273,550 V412I probably benign Het
Arid3c T C 4: 41,730,072 E41G possibly damaging Het
Atp8b4 T A 2: 126,322,816 K1193N probably benign Het
C4a C T 17: 34,816,999 noncoding transcript Het
Chst2 C T 9: 95,405,364 D310N probably damaging Het
Crtc3 T C 7: 80,677,422 Q52R possibly damaging Het
Crybg1 T C 10: 43,998,587 I842V probably benign Het
Dennd4c T C 4: 86,825,274 S1167P probably benign Het
Edem3 T C 1: 151,792,385 V305A possibly damaging Het
Epha10 T A 4: 124,886,214 probably null Het
Epha6 C A 16: 59,654,063 R1117L probably damaging Het
Fdx1l T C 9: 21,067,864 I144V possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm14139 T A 2: 150,192,061 C132S probably damaging Het
Gm4737 G A 16: 46,154,192 T274I probably damaging Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Inpp5f A G 7: 128,685,129 I577M probably damaging Het
Kansl2 G A 15: 98,526,661 T296I possibly damaging Het
Kcna6 A G 6: 126,738,424 F501L probably benign Het
Kirrel2 A T 7: 30,449,868 V579D probably benign Het
Larp1b T C 3: 40,970,570 Y208H probably damaging Het
Lipf A T 19: 33,965,688 D132V probably benign Het
Lsm12 T C 11: 102,167,163 K40E probably damaging Het
Mastl A G 2: 23,137,026 S275P probably benign Het
Mrpl44 A G 1: 79,780,977 I281V probably benign Het
Mtf1 T A 4: 124,804,712 M1K probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh2 G A 11: 67,176,255 G179R probably damaging Het
Nfasc T C 1: 132,603,830 T739A possibly damaging Het
Nfatc3 G A 8: 106,108,379 V778I probably benign Het
Notch4 A G 17: 34,578,716 probably benign Het
Npm2 T C 14: 70,652,402 N24S probably benign Het
Obox7 T A 7: 14,664,485 L108Q probably damaging Het
Olfr615 T A 7: 103,560,761 F95I probably benign Het
Pax3 A G 1: 78,132,232 V263A probably damaging Het
Pdlim1 C T 19: 40,223,136 V238I probably damaging Het
Pik3ip1 G A 11: 3,330,928 probably benign Het
Ptprq A G 10: 107,710,581 V284A possibly damaging Het
Rad9b G A 5: 122,339,776 T179I probably damaging Het
Rrnad1 C A 3: 87,924,998 R293L probably benign Het
Sirt4 G T 5: 115,479,726 D290E possibly damaging Het
Skint6 T A 4: 112,955,392 probably benign Het
Slc18a1 A C 8: 69,040,299 I466S probably damaging Het
Slc35e4 C T 11: 3,912,889 R100H probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Tas1r1 C G 4: 152,032,674 V168L probably benign Het
Tmem233 T A 5: 116,083,163 Q8L possibly damaging Het
Ttc17 G T 2: 94,332,891 Q862K possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp229 T C 17: 21,743,904 I68T probably benign Het
Zfp423 A G 8: 87,904,500 V30A probably benign Het
Other mutations in Hus1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01543:Hus1 APN 11 9000082 missense probably benign 0.00
IGL01974:Hus1 APN 11 9000088 missense possibly damaging 0.58
IGL02301:Hus1 APN 11 8996915 missense probably benign
IGL02436:Hus1 APN 11 9006057 missense possibly damaging 0.93
R0694:Hus1 UTSW 11 9007531 nonsense probably null
R2108:Hus1 UTSW 11 9011110 start codon destroyed probably null 1.00
R2128:Hus1 UTSW 11 9006011 missense probably damaging 1.00
R2329:Hus1 UTSW 11 9007492 critical splice donor site probably null
R4363:Hus1 UTSW 11 8998676 missense probably damaging 1.00
R4420:Hus1 UTSW 11 9000133 missense probably damaging 1.00
R4453:Hus1 UTSW 11 9006035 missense probably damaging 1.00
R4572:Hus1 UTSW 11 9007617 splice site probably null
R4913:Hus1 UTSW 11 8996856 missense probably benign 0.03
R4989:Hus1 UTSW 11 9006027 missense probably damaging 0.97
R5402:Hus1 UTSW 11 9010240 critical splice donor site probably null
R5902:Hus1 UTSW 11 9010669 intron probably benign
R6402:Hus1 UTSW 11 9010407 missense probably damaging 1.00
R7792:Hus1 UTSW 11 9000133 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCATTGACAAACTGCTACTC -3'
(R):5'- CTCTAACTAGGTGTCATGAGGTGG -3'

Sequencing Primer
(F):5'- TGCTCAGTATGCATGACGC -3'
(R):5'- GTGGGGGCGAGGATCTGTC -3'
Posted On2016-02-04