Incidental Mutation 'R0420:Ggt1'
ID37002
Institutional Source Beutler Lab
Gene Symbol Ggt1
Ensembl Gene ENSMUSG00000006345
Gene Namegamma-glutamyltransferase 1
SynonymsGgtp, CD224, GGT, dwg
MMRRC Submission 038622-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R0420 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75561604-75586200 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 75576213 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006508] [ENSMUST00000124259] [ENSMUST00000125770] [ENSMUST00000128886] [ENSMUST00000129232] [ENSMUST00000131565] [ENSMUST00000134503] [ENSMUST00000139459] [ENSMUST00000140219] [ENSMUST00000141062] [ENSMUST00000143226] [ENSMUST00000143792] [ENSMUST00000145079] [ENSMUST00000145928] [ENSMUST00000151212] [ENSMUST00000152657]
Predicted Effect probably benign
Transcript: ENSMUST00000006508
SMART Domains Protein: ENSMUSP00000006508
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 4.9e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124259
SMART Domains Protein: ENSMUSP00000122616
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 235 1.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125770
SMART Domains Protein: ENSMUSP00000117968
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 88 7.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128886
SMART Domains Protein: ENSMUSP00000118261
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 126 2.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129020
SMART Domains Protein: ENSMUSP00000118825
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 263 3.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129232
SMART Domains Protein: ENSMUSP00000115118
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 189 9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131565
SMART Domains Protein: ENSMUSP00000119844
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 126 2.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134503
SMART Domains Protein: ENSMUSP00000121312
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 1.4e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139459
SMART Domains Protein: ENSMUSP00000121774
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 243 1.7e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140219
SMART Domains Protein: ENSMUSP00000118870
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 126 2.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141062
Predicted Effect probably benign
Transcript: ENSMUST00000143226
SMART Domains Protein: ENSMUSP00000115115
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 190 5.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143792
SMART Domains Protein: ENSMUSP00000117851
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 237 2.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145079
SMART Domains Protein: ENSMUSP00000115483
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 110 2.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145928
SMART Domains Protein: ENSMUSP00000118852
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 210 6.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148447
Predicted Effect probably benign
Transcript: ENSMUST00000151212
SMART Domains Protein: ENSMUSP00000119387
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
PDB:4GDX|A 23 60 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152657
SMART Domains Protein: ENSMUSP00000115818
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 110 2.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: This gene encodes gamma-glutamyl transpeptidase, a plasmamembrane-associated enzyme that cleaves the peptide bond between gamma-glutamyl and cysteinyl glycine moieties of glutathione. The encoded protein is autocatalytically processed to generate an enzymatically active heterodimer comprised of heavy and light chains. Mice lacking the encoded protein grow slowly, develop cataracts and have elevated levels of glutathione in plasma and urine. Transgenic overexpression of the encoded protein in mice enhances osteoclastic bone resorption. The mutant alleles termed 'Dwarf grey' and 'Dwarf grey Bayer' in mice are associated with deletions in this gene. A gamma-glutamyl transpeptidase paralog is located adjacent to this gene. Alternative splicing results in multiple transcript variants. Additional transcripts using alternate promoters and differing in 5' UTRs have been described. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutants may exhibit impaired growth, skeletal abnormalities, cataracts, lethargic behavior, premature greying, sterility, and shortened life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,571,094 S17G probably benign Het
Abcb4 T C 5: 8,941,050 V870A probably benign Het
Adam6b A T 12: 113,489,994 M144L probably benign Het
Adrb2 T A 18: 62,179,539 I72L possibly damaging Het
Ankrd53 A T 6: 83,763,692 H99L probably damaging Het
Ap4e1 C T 2: 127,049,360 T17M probably damaging Het
Arnt T A 3: 95,470,394 probably benign Het
Atp1a3 C T 7: 24,980,627 G884E probably benign Het
Atp6v1b1 T C 6: 83,752,844 probably benign Het
Atp8a2 G T 14: 59,773,744 T971K probably damaging Het
BC048562 A T 9: 108,445,966 T167S probably benign Het
Brd9 A G 13: 73,955,473 M491V probably benign Het
Btnl10 A T 11: 58,923,451 D319V probably damaging Het
Cadps T A 14: 12,491,800 R783S probably damaging Het
Ccdc149 A G 5: 52,400,239 probably benign Het
Ccm2l A T 2: 153,070,862 D107V probably null Het
Cep192 A G 18: 67,813,893 E213G possibly damaging Het
Cyp2c37 A C 19: 39,995,794 N242T probably benign Het
Dnah17 A G 11: 118,039,939 V3750A probably damaging Het
Ehbp1 T A 11: 22,151,836 I231L probably benign Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eya4 T C 10: 23,155,963 N254S possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Fancd2 T C 6: 113,536,979 L108P probably damaging Het
Fgf12 A T 16: 28,162,529 M145K possibly damaging Het
Gabbr1 A G 17: 37,046,762 N23S possibly damaging Het
Gm1966 T A 7: 106,603,883 L51F probably damaging Het
Gm6434 T A 7: 25,882,361 noncoding transcript Het
Gm6614 T G 6: 141,985,477 probably benign Het
Grik4 A T 9: 42,622,096 L376* probably null Het
Gzf1 A G 2: 148,683,833 T75A probably benign Het
Hcn1 T C 13: 117,975,375 I625T unknown Het
Hhat C T 1: 192,552,934 probably null Het
Ifit1bl1 T C 19: 34,594,514 E181G probably damaging Het
Kif21a T C 15: 90,968,054 probably benign Het
Lrrc45 A C 11: 120,715,219 S118R probably damaging Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Ms4a5 A G 19: 11,283,654 L47S probably damaging Het
Mynn A T 3: 30,607,459 N230I probably benign Het
Nck2 T C 1: 43,554,118 S162P probably damaging Het
Nfat5 T C 8: 107,367,461 F259S probably damaging Het
Obox1 T G 7: 15,556,253 S174A possibly damaging Het
Ociad1 T A 5: 73,313,429 probably null Het
Pgbd1 A T 13: 21,423,166 V286E possibly damaging Het
Phlpp2 T C 8: 109,939,935 V1032A probably damaging Het
Ppm1e C T 11: 87,240,614 A318T probably damaging Het
Prex1 T A 2: 166,589,571 D757V probably benign Het
Ptpdc1 C A 13: 48,589,119 probably null Het
Rbbp5 T G 1: 132,493,844 I94R possibly damaging Het
Rnpc3 A G 3: 113,621,869 V173A probably benign Het
Sgsm1 A T 5: 113,263,759 N700K probably benign Het
Sox14 T A 9: 99,875,122 H188L probably damaging Het
Supt5 T A 7: 28,317,329 probably benign Het
Synpo A G 18: 60,602,418 S819P probably damaging Het
Tenm2 A G 11: 36,207,124 probably benign Het
Tenm4 T C 7: 96,873,766 V1468A possibly damaging Het
Tiam2 A G 17: 3,502,918 N83S probably benign Het
Tle6 T C 10: 81,595,311 probably benign Het
Tm2d2 T G 8: 25,018,114 N91K probably damaging Het
Tmem132d T G 5: 127,864,646 Q463H probably benign Het
Tmf1 A G 6: 97,176,141 S324P probably damaging Het
Tnc T C 4: 64,000,159 T1172A probably benign Het
Usp17lb A T 7: 104,840,539 C393S probably benign Het
Usp42 G A 5: 143,714,861 L1136F probably damaging Het
Vmn2r92 T G 17: 18,168,921 M499R probably benign Het
Vps54 T A 11: 21,311,071 probably benign Het
Wdr6 C T 9: 108,573,101 R1076H probably benign Het
Wdr72 T A 9: 74,210,757 M917K possibly damaging Het
Wee2 T C 6: 40,456,995 V281A probably benign Het
Zc3h6 A G 2: 129,014,827 D609G probably benign Het
Zfp345 G A 2: 150,473,243 H125Y possibly damaging Het
Zhx2 A G 15: 57,821,840 K202E probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Ggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Ggt1 APN 10 75584863 missense probably benign 0.15
IGL01593:Ggt1 APN 10 75585287 critical splice donor site probably null
IGL02713:Ggt1 APN 10 75574344 missense probably damaging 1.00
IGL03276:Ggt1 APN 10 75580497 unclassified probably benign
PIT4498001:Ggt1 UTSW 10 75578855 missense possibly damaging 0.95
R0373:Ggt1 UTSW 10 75579270 missense probably benign 0.11
R0505:Ggt1 UTSW 10 75585957 missense probably damaging 0.99
R0630:Ggt1 UTSW 10 75585502 splice site probably null
R1837:Ggt1 UTSW 10 75579294 missense probably benign 0.00
R2655:Ggt1 UTSW 10 75581385 nonsense probably null
R2656:Ggt1 UTSW 10 75581385 nonsense probably null
R2910:Ggt1 UTSW 10 75580596 missense probably benign 0.09
R3840:Ggt1 UTSW 10 75581385 nonsense probably null
R3841:Ggt1 UTSW 10 75581385 nonsense probably null
R4744:Ggt1 UTSW 10 75585899 missense probably benign 0.00
R5254:Ggt1 UTSW 10 75579198 unclassified probably null
R5323:Ggt1 UTSW 10 75585661 critical splice acceptor site probably null
R5326:Ggt1 UTSW 10 75585706 critical splice donor site probably null
R5512:Ggt1 UTSW 10 75584884 missense probably damaging 0.99
R5579:Ggt1 UTSW 10 75585948 missense probably damaging 1.00
R5707:Ggt1 UTSW 10 75585238 missense probably benign 0.01
R5961:Ggt1 UTSW 10 75585902 unclassified probably null
R6159:Ggt1 UTSW 10 75584965 missense probably damaging 1.00
R6239:Ggt1 UTSW 10 75585681 unclassified probably null
R7224:Ggt1 UTSW 10 75574276 missense possibly damaging 0.86
R7570:Ggt1 UTSW 10 75585594 missense probably damaging 1.00
R7649:Ggt1 UTSW 10 75585456 missense possibly damaging 0.89
R7702:Ggt1 UTSW 10 75576282 missense probably benign 0.00
R7713:Ggt1 UTSW 10 75585674 missense probably damaging 1.00
R7823:Ggt1 UTSW 10 75574341 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TATGGGGCTCATGAATGCCCACAG -3'
(R):5'- GAACTGACCCCTCCTTTCACGATG -3'

Sequencing Primer
(F):5'- CACAGTATGGGCATCGGG -3'
(R):5'- CACGATGGCGATTTAACCATCTG -3'
Posted On2013-05-09