Incidental Mutation 'R4818:Epha6'
ID 370021
Institutional Source Beutler Lab
Gene Symbol Epha6
Ensembl Gene ENSMUSG00000055540
Gene Name Eph receptor A6
Synonyms m-ehk2, Hek12, Ehk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4818 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 59653483-60605531 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 59654063 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1117 (R1117L)
Ref Sequence ENSEMBL: ENSMUSP00000066734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068860]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000068860
AA Change: R1117L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066734
Gene: ENSMUSG00000055540
AA Change: R1117L

DomainStartEndE-ValueType
low complexity region 4 37 N/A INTRINSIC
low complexity region 79 90 N/A INTRINSIC
low complexity region 104 115 N/A INTRINSIC
EPH_lbd 128 301 5.95e-125 SMART
Pfam:GCC2_GCC3 361 406 1.6e-8 PFAM
FN3 426 518 5.83e-3 SMART
FN3 537 618 2.19e-7 SMART
Pfam:EphA2_TM 644 722 1.8e-22 PFAM
TyrKc 725 1024 3.66e-122 SMART
SAM 1052 1119 1.24e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232302
Meta Mutation Damage Score 0.1092 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (73/73)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display discrete learning and memory deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,741,466 E562G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
A930033H14Rik A T 10: 69,212,360 probably benign Het
Abca17 C T 17: 24,317,161 E511K probably damaging Het
Abca9 C T 11: 110,155,154 probably null Het
Abhd5 T A 9: 122,363,800 probably null Het
Adra2b G A 2: 127,364,092 W171* probably null Het
Aldh1l1 T C 6: 90,596,915 Y799H probably benign Het
Arfgef1 A G 1: 10,216,547 V46A probably benign Het
Arhgap40 A G 2: 158,539,719 E374G probably damaging Het
Arhgef5 G A 6: 43,273,550 V412I probably benign Het
Arid3c T C 4: 41,730,072 E41G possibly damaging Het
Atp8b4 T A 2: 126,322,816 K1193N probably benign Het
C4a C T 17: 34,816,999 noncoding transcript Het
Chst2 C T 9: 95,405,364 D310N probably damaging Het
Crtc3 T C 7: 80,677,422 Q52R possibly damaging Het
Crybg1 T C 10: 43,998,587 I842V probably benign Het
Dennd4c T C 4: 86,825,274 S1167P probably benign Het
Edem3 T C 1: 151,792,385 V305A possibly damaging Het
Epha10 T A 4: 124,886,214 probably null Het
Fdx1l T C 9: 21,067,864 I144V possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm14139 T A 2: 150,192,061 C132S probably damaging Het
Gm4737 G A 16: 46,154,192 T274I probably damaging Het
Hus1 A G 11: 8,996,808 probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Inpp5f A G 7: 128,685,129 I577M probably damaging Het
Kansl2 G A 15: 98,526,661 T296I possibly damaging Het
Kcna6 A G 6: 126,738,424 F501L probably benign Het
Kirrel2 A T 7: 30,449,868 V579D probably benign Het
Larp1b T C 3: 40,970,570 Y208H probably damaging Het
Lipf A T 19: 33,965,688 D132V probably benign Het
Lsm12 T C 11: 102,167,163 K40E probably damaging Het
Mastl A G 2: 23,137,026 S275P probably benign Het
Mrpl44 A G 1: 79,780,977 I281V probably benign Het
Mtf1 T A 4: 124,804,712 M1K probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh2 G A 11: 67,176,255 G179R probably damaging Het
Nfasc T C 1: 132,603,830 T739A possibly damaging Het
Nfatc3 G A 8: 106,108,379 V778I probably benign Het
Notch4 A G 17: 34,578,716 probably benign Het
Npm2 T C 14: 70,652,402 N24S probably benign Het
Obox7 T A 7: 14,664,485 L108Q probably damaging Het
Olfr615 T A 7: 103,560,761 F95I probably benign Het
Pax3 A G 1: 78,132,232 V263A probably damaging Het
Pdlim1 C T 19: 40,223,136 V238I probably damaging Het
Pik3ip1 G A 11: 3,330,928 probably benign Het
Ptprq A G 10: 107,710,581 V284A possibly damaging Het
Rad9b G A 5: 122,339,776 T179I probably damaging Het
Rrnad1 C A 3: 87,924,998 R293L probably benign Het
Sirt4 G T 5: 115,479,726 D290E possibly damaging Het
Skint6 T A 4: 112,955,392 probably benign Het
Slc18a1 A C 8: 69,040,299 I466S probably damaging Het
Slc35e4 C T 11: 3,912,889 R100H probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Tas1r1 C G 4: 152,032,674 V168L probably benign Het
Tmem233 T A 5: 116,083,163 Q8L possibly damaging Het
Ttc17 G T 2: 94,332,891 Q862K possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp229 T C 17: 21,743,904 I68T probably benign Het
Zfp423 A G 8: 87,904,500 V30A probably benign Het
Other mutations in Epha6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Epha6 APN 16 59915962 missense probably damaging 1.00
IGL00849:Epha6 APN 16 60425111 missense possibly damaging 0.89
IGL00898:Epha6 APN 16 59775541 critical splice donor site probably null
IGL01353:Epha6 APN 16 60424895 missense probably damaging 1.00
IGL01409:Epha6 APN 16 59655737 nonsense probably null
IGL01577:Epha6 APN 16 59956926 missense possibly damaging 0.57
IGL01653:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01654:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01655:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01657:Epha6 APN 16 59839303 missense probably benign 0.05
IGL01663:Epha6 APN 16 59775644 missense probably damaging 1.00
IGL01899:Epha6 APN 16 59839303 missense probably benign 0.05
IGL02272:Epha6 APN 16 59818937 missense probably damaging 1.00
IGL03265:Epha6 APN 16 60060231 splice site probably benign
IGL03333:Epha6 APN 16 59682688 missense probably damaging 1.00
rauwulfia UTSW 16 59682616 missense probably damaging 1.00
PIT4377001:Epha6 UTSW 16 60205552 missense probably damaging 0.98
R0505:Epha6 UTSW 16 60205732 missense possibly damaging 0.89
R1593:Epha6 UTSW 16 60424904 missense probably damaging 1.00
R1764:Epha6 UTSW 16 59775728 missense probably null 1.00
R1836:Epha6 UTSW 16 60205745 missense probably damaging 1.00
R2061:Epha6 UTSW 16 59655797 missense probably damaging 1.00
R2125:Epha6 UTSW 16 59682688 missense probably damaging 1.00
R2867:Epha6 UTSW 16 59960296 splice site probably null
R2867:Epha6 UTSW 16 59960296 splice site probably null
R3760:Epha6 UTSW 16 60220984 missense possibly damaging 0.70
R4305:Epha6 UTSW 16 60526520 splice site probably null
R4613:Epha6 UTSW 16 59666597 missense possibly damaging 0.80
R4832:Epha6 UTSW 16 59960413 missense probably damaging 0.98
R4895:Epha6 UTSW 16 59666555 missense probably benign 0.08
R5014:Epha6 UTSW 16 59666579 missense probably benign 0.00
R5316:Epha6 UTSW 16 59954720 missense probably damaging 0.99
R5403:Epha6 UTSW 16 59775570 missense probably damaging 1.00
R5417:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5418:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R5678:Epha6 UTSW 16 59818979 missense probably damaging 1.00
R5775:Epha6 UTSW 16 59818994 missense possibly damaging 0.92
R5808:Epha6 UTSW 16 59682742 missense probably damaging 1.00
R6076:Epha6 UTSW 16 60205710 missense probably damaging 1.00
R6146:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6212:Epha6 UTSW 16 60425356 missense possibly damaging 0.77
R6242:Epha6 UTSW 16 59682662 missense probably damaging 1.00
R6503:Epha6 UTSW 16 60205621 missense possibly damaging 0.61
R6580:Epha6 UTSW 16 59682616 missense probably damaging 1.00
R6726:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6728:Epha6 UTSW 16 60424835 missense possibly damaging 0.89
R6798:Epha6 UTSW 16 60605064 missense possibly damaging 0.53
R6798:Epha6 UTSW 16 60605065 missense possibly damaging 0.53
R6903:Epha6 UTSW 16 60526462 missense probably benign 0.00
R6999:Epha6 UTSW 16 60425170 missense possibly damaging 0.94
R7058:Epha6 UTSW 16 59682650 missense probably damaging 1.00
R7109:Epha6 UTSW 16 59682668 missense probably damaging 1.00
R7263:Epha6 UTSW 16 59775665 missense probably damaging 1.00
R7296:Epha6 UTSW 16 59915838 missense probably benign 0.00
R7343:Epha6 UTSW 16 59960430 missense probably damaging 0.98
R7443:Epha6 UTSW 16 59775625 missense possibly damaging 0.93
R7533:Epha6 UTSW 16 60205562 missense probably damaging 1.00
R7602:Epha6 UTSW 16 59775568 missense probably damaging 1.00
R7604:Epha6 UTSW 16 60205772 missense possibly damaging 0.89
R8321:Epha6 UTSW 16 59915954 missense probably damaging 1.00
R8414:Epha6 UTSW 16 60005667 missense probably damaging 1.00
R8794:Epha6 UTSW 16 60205672 missense probably benign 0.00
R8926:Epha6 UTSW 16 59839299 missense probably benign 0.11
R9166:Epha6 UTSW 16 60604875 missense probably benign 0.00
R9265:Epha6 UTSW 16 59655754 missense probably damaging 1.00
R9322:Epha6 UTSW 16 60424755 missense probably damaging 1.00
Z1188:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Z1189:Epha6 UTSW 16 59654090 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAACGTAAGGTGTGCAGCC -3'
(R):5'- AGCTAAGTATTCATTTTCTCTGGCTCG -3'

Sequencing Primer
(F):5'- CGTAAGGTGTGCAGCCATAGTC -3'
(R):5'- GGCTCGTTTTTATTAACTCTAGATGC -3'
Posted On 2016-02-04