Incidental Mutation 'R4818:Lipf'
ID370025
Institutional Source Beutler Lab
Gene Symbol Lipf
Ensembl Gene ENSMUSG00000024768
Gene Namelipase, gastric
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4818 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location33961187-33976810 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33965688 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 132 (D132V)
Ref Sequence ENSEMBL: ENSMUSP00000025680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025680]
Predicted Effect probably benign
Transcript: ENSMUST00000025680
AA Change: D132V

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000025680
Gene: ENSMUSG00000024768
AA Change: D132V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Abhydro_lipase 34 96 2.9e-27 PFAM
Pfam:Abhydrolase_1 77 377 2.3e-26 PFAM
Pfam:Abhydrolase_5 78 372 1.5e-9 PFAM
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes gastric lipase, an enzyme involved in the digestion of dietary triglycerides in the gastrointestinal tract, and responsible for 30% of fat digestion processes occurring in human. It is secreted by gastric chief cells in the fundic mucosa of the stomach, and it hydrolyzes the ester bonds of triglycerides under acidic pH conditions. The gene is a member of a conserved gene family of lipases that play distinct roles in neutral lipid metabolism. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik A G 2: 68,741,466 E562G probably benign Het
5730522E02Rik A G 11: 25,770,472 probably null Het
A930033H14Rik A T 10: 69,212,360 probably benign Het
Abca17 C T 17: 24,317,161 E511K probably damaging Het
Abca9 C T 11: 110,155,154 probably null Het
Abhd5 T A 9: 122,363,800 probably null Het
Adra2b G A 2: 127,364,092 W171* probably null Het
Aldh1l1 T C 6: 90,596,915 Y799H probably benign Het
Arfgef1 A G 1: 10,216,547 V46A probably benign Het
Arhgap40 A G 2: 158,539,719 E374G probably damaging Het
Arhgef5 G A 6: 43,273,550 V412I probably benign Het
Arid3c T C 4: 41,730,072 E41G possibly damaging Het
Atp8b4 T A 2: 126,322,816 K1193N probably benign Het
C4a C T 17: 34,816,999 noncoding transcript Het
Chst2 C T 9: 95,405,364 D310N probably damaging Het
Crtc3 T C 7: 80,677,422 Q52R possibly damaging Het
Crybg1 T C 10: 43,998,587 I842V probably benign Het
Dennd4c T C 4: 86,825,274 S1167P probably benign Het
Edem3 T C 1: 151,792,385 V305A possibly damaging Het
Epha10 T A 4: 124,886,214 probably null Het
Epha6 C A 16: 59,654,063 R1117L probably damaging Het
Fdx1l T C 9: 21,067,864 I144V possibly damaging Het
Gm10762 C T 2: 128,967,186 W81* probably null Het
Gm14139 T A 2: 150,192,061 C132S probably damaging Het
Gm4737 G A 16: 46,154,192 T274I probably damaging Het
Hus1 A G 11: 8,996,808 probably benign Het
Igbp1b C T 6: 138,657,805 E214K probably benign Het
Inpp5f A G 7: 128,685,129 I577M probably damaging Het
Kansl2 G A 15: 98,526,661 T296I possibly damaging Het
Kcna6 A G 6: 126,738,424 F501L probably benign Het
Kirrel2 A T 7: 30,449,868 V579D probably benign Het
Larp1b T C 3: 40,970,570 Y208H probably damaging Het
Lsm12 T C 11: 102,167,163 K40E probably damaging Het
Mastl A G 2: 23,137,026 S275P probably benign Het
Mrpl44 A G 1: 79,780,977 I281V probably benign Het
Mtf1 T A 4: 124,804,712 M1K probably null Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh2 G A 11: 67,176,255 G179R probably damaging Het
Nfasc T C 1: 132,603,830 T739A possibly damaging Het
Nfatc3 G A 8: 106,108,379 V778I probably benign Het
Notch4 A G 17: 34,578,716 probably benign Het
Npm2 T C 14: 70,652,402 N24S probably benign Het
Obox7 T A 7: 14,664,485 L108Q probably damaging Het
Olfr615 T A 7: 103,560,761 F95I probably benign Het
Pax3 A G 1: 78,132,232 V263A probably damaging Het
Pdlim1 C T 19: 40,223,136 V238I probably damaging Het
Pik3ip1 G A 11: 3,330,928 probably benign Het
Ptprq A G 10: 107,710,581 V284A possibly damaging Het
Rad9b G A 5: 122,339,776 T179I probably damaging Het
Rrnad1 C A 3: 87,924,998 R293L probably benign Het
Sirt4 G T 5: 115,479,726 D290E possibly damaging Het
Skint6 T A 4: 112,955,392 probably benign Het
Slc18a1 A C 8: 69,040,299 I466S probably damaging Het
Slc35e4 C T 11: 3,912,889 R100H probably benign Het
Sptbn5 T G 2: 120,067,968 K470Q probably benign Het
Tas1r1 C G 4: 152,032,674 V168L probably benign Het
Tmem233 T A 5: 116,083,163 Q8L possibly damaging Het
Ttc17 G T 2: 94,332,891 Q862K possibly damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfp229 T C 17: 21,743,904 I68T probably benign Het
Zfp423 A G 8: 87,904,500 V30A probably benign Het
Other mutations in Lipf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01902:Lipf APN 19 33970779 missense probably benign 0.33
IGL02024:Lipf APN 19 33976595 missense probably damaging 1.00
R1427:Lipf UTSW 19 33965600 missense probably damaging 1.00
R1454:Lipf UTSW 19 33970732 splice site probably benign
R1484:Lipf UTSW 19 33964780 missense probably benign 0.00
R1636:Lipf UTSW 19 33976535 missense probably damaging 1.00
R1720:Lipf UTSW 19 33965666 nonsense probably null
R1916:Lipf UTSW 19 33965675 missense probably benign 0.07
R2010:Lipf UTSW 19 33973546 missense probably benign
R2519:Lipf UTSW 19 33965525 missense probably damaging 0.99
R2937:Lipf UTSW 19 33973038 missense probably damaging 1.00
R4063:Lipf UTSW 19 33965565 missense probably benign 0.43
R4640:Lipf UTSW 19 33968797 missense probably damaging 0.98
R4671:Lipf UTSW 19 33976676 missense possibly damaging 0.94
R5619:Lipf UTSW 19 33966892 missense possibly damaging 0.95
R6034:Lipf UTSW 19 33964889 missense probably benign
R6034:Lipf UTSW 19 33964889 missense probably benign
R6045:Lipf UTSW 19 33966844 missense probably damaging 1.00
R6464:Lipf UTSW 19 33973544 missense probably benign 0.00
R7502:Lipf UTSW 19 33976606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCCTAGGCAAGAGACCTG -3'
(R):5'- TGGTATGGAGGTCACAGCAAAC -3'

Sequencing Primer
(F):5'- CAAGAGACCTGTGGCATATTTG -3'
(R):5'- AACACTGCCCTTGGATTGAG -3'
Posted On2016-02-04