Incidental Mutation 'R4819:Fcrla'
ID370031
Institutional Source Beutler Lab
Gene Symbol Fcrla
Ensembl Gene ENSMUSG00000038421
Gene NameFc receptor-like A
SynonymsFREB, Fcrx, Freb1, mFcrX, mFREB, FCRL1
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location170917576-170927583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 170920939 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 212 (I212F)
Ref Sequence ENSEMBL: ENSMUSP00000124859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046322] [ENSMUST00000159149] [ENSMUST00000159171] [ENSMUST00000162136] [ENSMUST00000162887]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046322
AA Change: I238F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036380
Gene: ENSMUSG00000038421
AA Change: I238F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
IG 95 177 5.75e-4 SMART
IG 188 272 1.4e-7 SMART
low complexity region 281 296 N/A INTRINSIC
low complexity region 310 323 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000159149
AA Change: D164V
SMART Domains Protein: ENSMUSP00000125074
Gene: ENSMUSG00000038421
AA Change: D164V

DomainStartEndE-ValueType
low complexity region 20 33 N/A INTRINSIC
IG 66 148 5.75e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159171
AA Change: I237F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124853
Gene: ENSMUSG00000038421
AA Change: I237F

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 48 61 N/A INTRINSIC
IG 94 176 5.75e-4 SMART
IG 187 271 1.4e-7 SMART
low complexity region 280 295 N/A INTRINSIC
low complexity region 309 322 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161050
Predicted Effect probably damaging
Transcript: ENSMUST00000162136
AA Change: I212F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124859
Gene: ENSMUSG00000038421
AA Change: I212F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
Pfam:Ig_2 83 150 2.2e-6 PFAM
Pfam:Ig_2 156 215 1e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162887
SMART Domains Protein: ENSMUSP00000124469
Gene: ENSMUSG00000038421

DomainStartEndE-ValueType
Pfam:Ig_2 28 78 1.4e-7 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to receptors for the Fc fragment of gamma immunoglobulin (IgG). These receptors, referred to as FCGRs, mediate the destruction of IgG-coated antigens and of cells induced by antibodies. This encoded protein is selectively expressed in B cells, and may be involved in their development. This protein may also be involved in the development of lymphomas. Multiple alternatively spliced transcript variants that encode different protein isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit largely normal T-dependent and T-independent antibody responses with an increase in IgG1 after secondary challenge with sheep red blood cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Fcrla
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Fcrla APN 1 170927498 missense probably benign 0.00
IGL01712:Fcrla APN 1 170921623 unclassified probably null
IGL03323:Fcrla APN 1 170927545 utr 5 prime probably benign
R0113:Fcrla UTSW 1 170922299 start codon destroyed probably null 0.66
R1457:Fcrla UTSW 1 170921004 missense probably damaging 1.00
R1917:Fcrla UTSW 1 170927526 nonsense probably null
R4331:Fcrla UTSW 1 170921676 missense possibly damaging 0.74
R4923:Fcrla UTSW 1 170921113 missense probably damaging 1.00
R5000:Fcrla UTSW 1 170922390 missense probably benign 0.03
R5441:Fcrla UTSW 1 170925422 intron probably benign
R5459:Fcrla UTSW 1 170918169 missense possibly damaging 0.68
R6575:Fcrla UTSW 1 170922228 missense probably damaging 1.00
R7369:Fcrla UTSW 1 170922317 missense probably benign 0.23
R7786:Fcrla UTSW 1 170920857 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AGACTTTGGATTATTGCCCTGTC -3'
(R):5'- TTGCAGCCCCAGTTCTCAAAG -3'

Sequencing Primer
(F):5'- GTTCCTCCAGAGTTCGGTTGATAAAC -3'
(R):5'- AAAGCCTTACCTTCTAGTGAGC -3'
Posted On2016-02-04