Mutagenetix > Incidental Mutations

Incidental Mutation 'R4819:Adgrf3'

370044

Institutional Source

Beutler Lab

Gene Symbol

Adgrf3

Ensembl Gene

ENSMUSG00000067642

Gene Name

adhesion G protein-coupled receptor F3

Synonyms

Gpr113, LOC381628, PGR23

MMRRC Submission

042000-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4819 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30193431-30205722 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 30198444 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 444 (L444F)

Ref Sequence

ENSEMBL: ENSMUSP00000085440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088117] [ENSMUST00000125367]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088117
AA Change: L444F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000085440
Gene: ENSMUSG00000067642
AA Change: L444F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
Blast:IG	163	252	2e-20	BLAST
Blast:CCP	341	399	1e-6	BLAST
low complexity region	403	415	N/A	INTRINSIC
low complexity region	471	483	N/A	INTRINSIC
GPS	632	684	2.68e-17	SMART
Pfam:7tm_2	687	935	1e-30	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114774
AA Change: L444F

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000110422
Gene: ENSMUSG00000067642
AA Change: L444F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	85	97	N/A	INTRINSIC
Blast:IG	163	252	2e-20	BLAST
Blast:CCP	341	399	1e-6	BLAST
Pfam:DUF3497	417	609	1.1e-12	PFAM
GPS	631	683	2.68e-17	SMART
Pfam:7tm_2	686	934	5.3e-31	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000125367

SMART Domains

Protein: ENSMUSP00000120958
Gene: ENSMUSG00000067642

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135322

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,290,421	N761K	possibly damaging	Het
Akap8	G	A	17: 32,312,305	R378W	probably damaging	Het
Amotl2	C	T	9: 102,730,071	R693W	probably damaging	Het
As3mt	G	T	19: 46,707,529		probably benign	Het
Atp6v1e2	A	G	17: 86,944,538	V144A	probably benign	Het
Bfar	C	T	16: 13,687,467	Q114*	probably null	Het
Casd1	C	T	6: 4,621,225	A261V	probably damaging	Het
Ccdc36	A	G	9: 108,406,678	V189A	probably benign	Het
Cd177	A	T	7: 24,752,271	I440K	probably damaging	Het
Cfap54	G	T	10: 92,836,477	Y2910*	probably null	Het
Csl	A	G	10: 99,758,082	F374L	possibly damaging	Het
Dctn1	G	A	6: 83,190,519	R275H	probably damaging	Het
Derl3	A	G	10: 75,893,879		probably null	Het
Dst	A	G	1: 33,968,835	I117V	probably benign	Het
Edc3	T	A	9: 57,748,397	C477S	possibly damaging	Het
Efs	T	C	14: 54,917,153	E450G	probably damaging	Het
Fcrla	T	A	1: 170,920,939	I212F	probably damaging	Het
Fsip2	A	G	2: 82,988,442	I4840V	probably benign	Het
Gm14025	G	T	2: 129,040,801	N98K	probably damaging	Het
Gpam	T	A	19: 55,078,341	I581F	probably benign	Het
Greb1l	A	G	18: 10,458,358	D45G	probably damaging	Het
Heca	A	G	10: 17,908,072	Y478H	probably damaging	Het
Hspa9	C	T	18: 34,939,388	M561I	probably damaging	Het
Hyal6	T	A	6: 24,734,966	Y299*	probably null	Het
Ik	T	A	18: 36,753,257		probably null	Het
Khsrp	A	G	17: 57,023,360	S582P	possibly damaging	Het
Kif18a	A	G	2: 109,292,126	D182G	probably damaging	Het
Krt2	T	C	15: 101,811,544	T564A	unknown	Het
Lig4	A	G	8: 9,971,885	S632P	probably benign	Het
Med1	C	T	11: 98,155,432		probably benign	Het
Mgat3	T	A	15: 80,212,349	I459N	probably damaging	Het
Mkln1	A	T	6: 31,474,486	Q454L	probably benign	Het
Mn1	A	G	5: 111,419,937	E591G	possibly damaging	Het
Myo5c	T	A	9: 75,292,202	L1364Q	probably damaging	Het
Oas1d	T	C	5: 120,915,717	V80A	probably damaging	Het
Obscn	A	T	11: 59,038,848	D5180E	probably damaging	Het
Pax6	G	A	2: 105,692,277		probably null	Het
Pcdh15	A	C	10: 74,324,389	N446T	probably damaging	Het
Pcnx2	A	T	8: 125,855,230	F922L	probably benign	Het
Ptpn4	G	T	1: 119,659,850	T921K	probably benign	Het
Selenov	A	G	7: 28,290,321		probably null	Het
Tmem100	A	G	11: 90,035,445	T33A	probably benign	Het
Tmem59	C	T	4: 107,187,681	Q66*	probably null	Het
Trav21-dv12	T	A	14: 53,876,613	Y63*	probably null	Het
Trim66	G	T	7: 109,457,586	H1121Q	probably damaging	Het
Trim80	A	G	11: 115,447,943	Y533C	probably damaging	Het
Ttc17	G	A	2: 94,364,610	P520L	probably damaging	Het
Ttn	A	T	2: 76,791,749	V15483E	probably damaging	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfhx4	C	A	3: 5,403,914	T3069K	probably benign	Het
Zfp281	A	G	1: 136,625,710	H142R	probably benign	Het
Zfp462	G	T	4: 55,060,044	R1190L	probably damaging	Het
Zfp935	T	A	13: 62,454,417	H323L	probably damaging	Het

Other mutations in Adgrf3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03080:Adgrf3	APN	5	30196829	missense	probably benign	0.02
IGL03171:Adgrf3	APN	5	30196294	missense	probably damaging	1.00
R0010:Adgrf3	UTSW	5	30205609	splice site	probably benign
R0042:Adgrf3	UTSW	5	30197428	missense	probably damaging	1.00
R0140:Adgrf3	UTSW	5	30196381	missense	probably benign	0.19
R0617:Adgrf3	UTSW	5	30195080	missense	probably benign	0.25
R0748:Adgrf3	UTSW	5	30196876	missense	probably damaging	1.00
R1291:Adgrf3	UTSW	5	30199534	missense	probably damaging	0.99
R1330:Adgrf3	UTSW	5	30195095	missense	probably benign	0.24
R1468:Adgrf3	UTSW	5	30202229	splice site	probably benign
R1695:Adgrf3	UTSW	5	30203555	missense	probably benign	0.05
R1716:Adgrf3	UTSW	5	30197551	missense	probably benign	0.03
R1844:Adgrf3	UTSW	5	30199213	missense	probably damaging	0.96
R1935:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R1936:Adgrf3	UTSW	5	30202306	missense	probably benign	0.00
R2059:Adgrf3	UTSW	5	30199491	missense	possibly damaging	0.91
R2656:Adgrf3	UTSW	5	30196438	missense	possibly damaging	0.96
R2913:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2914:Adgrf3	UTSW	5	30196994	missense	probably damaging	1.00
R2987:Adgrf3	UTSW	5	30197360	missense	probably damaging	1.00
R3797:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3798:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3799:Adgrf3	UTSW	5	30196823	missense	possibly damaging	0.49
R3934:Adgrf3	UTSW	5	30200434	unclassified	probably benign
R4043:Adgrf3	UTSW	5	30204362	missense	probably benign	0.00
R4080:Adgrf3	UTSW	5	30197369	nonsense	probably null
R4575:Adgrf3	UTSW	5	30202257	missense	probably benign	0.00
R4754:Adgrf3	UTSW	5	30197617	critical splice acceptor site	probably null
R4893:Adgrf3	UTSW	5	30200478	missense	probably benign	0.00
R4991:Adgrf3	UTSW	5	30199148	missense	probably benign	0.26
R5686:Adgrf3	UTSW	5	30197306	missense	probably damaging	1.00
R5965:Adgrf3	UTSW	5	30205639	missense	probably benign	0.00
R5997:Adgrf3	UTSW	5	30198362	critical splice donor site	probably null
R6103:Adgrf3	UTSW	5	30196267	missense	probably damaging	1.00
R6244:Adgrf3	UTSW	5	30197533	missense	probably benign	0.17
R6409:Adgrf3	UTSW	5	30197314	missense	probably damaging	0.96
R6575:Adgrf3	UTSW	5	30196524	missense	possibly damaging	0.72
R6745:Adgrf3	UTSW	5	30203603	missense	probably benign	0.31
R6790:Adgrf3	UTSW	5	30196387	missense	probably benign	0.00
R6813:Adgrf3	UTSW	5	30197521	missense	probably damaging	0.96
R7202:Adgrf3	UTSW	5	30204380	nonsense	probably null
R7250:Adgrf3	UTSW	5	30195682	missense	probably damaging	1.00
R7353:Adgrf3	UTSW	5	30198497	missense	probably damaging	0.98
R7634:Adgrf3	UTSW	5	30202247	missense	probably benign	0.01
R7658:Adgrf3	UTSW	5	30197206	missense	probably benign	0.41
R8037:Adgrf3	UTSW	5	30199512	missense	probably damaging	1.00
Z1088:Adgrf3	UTSW	5	30199120	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TTACAGAGATAGCAGGAACCCC -3'
(R):5'- GTAGCCGTTCCTTCTGCATG -3'

Sequencing Primer
(F):5'- GCCTAAAAAGGTCCCTGTTGG -3'
(R):5'- TCCTCTGAGGGGTGCAG -3'

Posted On

2016-02-04