Mutagenetix > Incidental Mutation

Incidental Mutation 'R4819:Trim66'

370053

Institutional Source

Beutler Lab

Gene Symbol

Trim66

Ensembl Gene

ENSMUSG00000031026

Gene Name

tripartite motif-containing 66

Synonyms

Tif1d, D7H11orf29

MMRRC Submission

042000-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R4819 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109449006-109508134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 109457586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Glutamine at position 1121 (H1121Q)

Ref Sequence

ENSEMBL: ENSMUSP00000102352 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033339] [ENSMUST00000106739] [ENSMUST00000106741]

AlphaFold

Q924W6

Predicted Effect

probably damaging
Transcript: ENSMUST00000033339
AA Change: H1019Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000033339
Gene: ENSMUSG00000031026
AA Change: H1019Q

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106739
AA Change: H1019Q

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000102350
Gene: ENSMUSG00000031026
AA Change: H1019Q

Domain	Start	End	E-Value	Type
PHD	4	69	7.77e0	SMART
BBC	108	234	1.61e-39	SMART
low complexity region	318	333	N/A	INTRINSIC
low complexity region	452	486	N/A	INTRINSIC
low complexity region	517	530	N/A	INTRINSIC
low complexity region	568	581	N/A	INTRINSIC
PHD	998	1041	4.09e-10	SMART
BROMO	1069	1175	8.22e-27	SMART
low complexity region	1185	1199	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106741
AA Change: H1121Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000102352
Gene: ENSMUSG00000031026
AA Change: H1121Q

Domain	Start	End	E-Value	Type
RING	28	78	2.38e-2	SMART
BBOX	102	140	1.48e0	SMART
PHD	106	171	7.77e0	SMART
RING	107	170	4.38e0	SMART
BBOX	162	203	4.21e-3	SMART
BBC	210	336	1.61e-39	SMART
low complexity region	420	435	N/A	INTRINSIC
low complexity region	554	588	N/A	INTRINSIC
low complexity region	619	632	N/A	INTRINSIC
low complexity region	670	683	N/A	INTRINSIC
PHD	1100	1143	4.09e-10	SMART
BROMO	1171	1277	8.22e-27	SMART
low complexity region	1287	1301	N/A	INTRINSIC

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,290,421	N761K	possibly damaging	Het
Adgrf3	T	A	5: 30,198,444	L444F	possibly damaging	Het
Akap8	G	A	17: 32,312,305	R378W	probably damaging	Het
Amotl2	C	T	9: 102,730,071	R693W	probably damaging	Het
As3mt	G	T	19: 46,707,529		probably benign	Het
Atp6v1e2	A	G	17: 86,944,538	V144A	probably benign	Het
Bfar	C	T	16: 13,687,467	Q114*	probably null	Het
Casd1	C	T	6: 4,621,225	A261V	probably damaging	Het
Ccdc36	A	G	9: 108,406,678	V189A	probably benign	Het
Cd177	A	T	7: 24,752,271	I440K	probably damaging	Het
Cfap54	G	T	10: 92,836,477	Y2910*	probably null	Het
Csl	A	G	10: 99,758,082	F374L	possibly damaging	Het
Dctn1	G	A	6: 83,190,519	R275H	probably damaging	Het
Derl3	A	G	10: 75,893,879		probably null	Het
Dst	A	G	1: 33,968,835	I117V	probably benign	Het
Edc3	T	A	9: 57,748,397	C477S	possibly damaging	Het
Efs	T	C	14: 54,917,153	E450G	probably damaging	Het
Fcrla	T	A	1: 170,920,939	I212F	probably damaging	Het
Fsip2	A	G	2: 82,988,442	I4840V	probably benign	Het
Gm14025	G	T	2: 129,040,801	N98K	probably damaging	Het
Gpam	T	A	19: 55,078,341	I581F	probably benign	Het
Greb1l	A	G	18: 10,458,358	D45G	probably damaging	Het
Heca	A	G	10: 17,908,072	Y478H	probably damaging	Het
Hspa9	C	T	18: 34,939,388	M561I	probably damaging	Het
Hyal6	T	A	6: 24,734,966	Y299*	probably null	Het
Ik	T	A	18: 36,753,257		probably null	Het
Khsrp	A	G	17: 57,023,360	S582P	possibly damaging	Het
Kif18a	A	G	2: 109,292,126	D182G	probably damaging	Het
Krt2	T	C	15: 101,811,544	T564A	unknown	Het
Lig4	A	G	8: 9,971,885	S632P	probably benign	Het
Med1	C	T	11: 98,155,432		probably benign	Het
Mgat3	T	A	15: 80,212,349	I459N	probably damaging	Het
Mkln1	A	T	6: 31,474,486	Q454L	probably benign	Het
Mn1	A	G	5: 111,419,937	E591G	possibly damaging	Het
Myo5c	T	A	9: 75,292,202	L1364Q	probably damaging	Het
Oas1d	T	C	5: 120,915,717	V80A	probably damaging	Het
Obscn	A	T	11: 59,038,848	D5180E	probably damaging	Het
Pax6	G	A	2: 105,692,277		probably null	Het
Pcdh15	A	C	10: 74,324,389	N446T	probably damaging	Het
Pcnx2	A	T	8: 125,855,230	F922L	probably benign	Het
Ptpn4	G	T	1: 119,659,850	T921K	probably benign	Het
Selenov	A	G	7: 28,290,321		probably null	Het
Tmem100	A	G	11: 90,035,445	T33A	probably benign	Het
Tmem59	C	T	4: 107,187,681	Q66*	probably null	Het
Trav21-dv12	T	A	14: 53,876,613	Y63*	probably null	Het
Trim80	A	G	11: 115,447,943	Y533C	probably damaging	Het
Ttc17	G	A	2: 94,364,610	P520L	probably damaging	Het
Ttn	A	T	2: 76,791,749	V15483E	probably damaging	Het
Zdhhc1	CGGGGG	CGGGGGG	8: 105,483,744		probably null	Het
Zfhx4	C	A	3: 5,403,914	T3069K	probably benign	Het
Zfp281	A	G	1: 136,625,710	H142R	probably benign	Het
Zfp462	G	T	4: 55,060,044	R1190L	probably damaging	Het
Zfp935	T	A	13: 62,454,417	H323L	probably damaging	Het

Other mutations in Trim66

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01539:Trim66	APN	7	109455066	missense	probably benign	0.02
IGL01758:Trim66	APN	7	109486045	critical splice donor site	probably null
IGL01982:Trim66	APN	7	109458763	missense	probably benign	0.00
IGL01983:Trim66	APN	7	109458251	nonsense	probably null
IGL02149:Trim66	APN	7	109460902	missense	possibly damaging	0.66
IGL02392:Trim66	APN	7	109460274	missense	probably benign	0.01
IGL02483:Trim66	APN	7	109477630	splice site	probably benign
IGL02832:Trim66	APN	7	109460497	missense	probably damaging	1.00
IGL02945:Trim66	APN	7	109460176	nonsense	probably null
IGL03085:Trim66	APN	7	109458745	missense	probably benign	0.17
PIT1430001:Trim66	UTSW	7	109475247	missense	probably damaging	0.99
R0326:Trim66	UTSW	7	109460172	missense	probably benign	0.00
R0358:Trim66	UTSW	7	109460176	nonsense	probably null
R0401:Trim66	UTSW	7	109475264	missense	probably damaging	0.98
R0470:Trim66	UTSW	7	109457542	splice site	probably benign
R0568:Trim66	UTSW	7	109460695	missense	probably benign	0.00
R0669:Trim66	UTSW	7	109454992	intron	probably benign
R0980:Trim66	UTSW	7	109455670	missense	probably damaging	1.00
R1015:Trim66	UTSW	7	109455233	missense	probably damaging	1.00
R1078:Trim66	UTSW	7	109472319	missense	probably damaging	1.00
R1099:Trim66	UTSW	7	109475454	missense	probably benign	0.34
R1181:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R1497:Trim66	UTSW	7	109484619	missense	probably benign	0.00
R1583:Trim66	UTSW	7	109455080	missense	probably damaging	1.00
R1843:Trim66	UTSW	7	109475839	missense	probably damaging	0.99
R1998:Trim66	UTSW	7	109484577	critical splice donor site	probably null
R2016:Trim66	UTSW	7	109472232	critical splice donor site	probably null
R2143:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2144:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R2145:Trim66	UTSW	7	109475113	missense	probably damaging	0.98
R3945:Trim66	UTSW	7	109472268	missense	possibly damaging	0.94
R4012:Trim66	UTSW	7	109458131	missense	probably damaging	0.98
R4464:Trim66	UTSW	7	109477690	missense	possibly damaging	0.51
R4473:Trim66	UTSW	7	109481995	missense	probably damaging	1.00
R4729:Trim66	UTSW	7	109456060	critical splice donor site	probably null
R4730:Trim66	UTSW	7	109483069	missense	probably damaging	1.00
R4775:Trim66	UTSW	7	109457589	nonsense	probably null
R5269:Trim66	UTSW	7	109457590	missense	probably benign	0.00
R5557:Trim66	UTSW	7	109483737	missense	probably benign	0.06
R5832:Trim66	UTSW	7	109455202	missense	probably damaging	1.00
R6220:Trim66	UTSW	7	109483093	missense	probably damaging	0.97
R6243:Trim66	UTSW	7	109460274	missense	probably benign	0.01
R6374:Trim66	UTSW	7	109486062	missense	probably benign
R6450:Trim66	UTSW	7	109460738	missense	probably benign	0.09
R6543:Trim66	UTSW	7	109475879	missense	probably benign	0.01
R6788:Trim66	UTSW	7	109477754	missense	probably damaging	1.00
R6842:Trim66	UTSW	7	109460776	missense	probably benign	0.00
R7169:Trim66	UTSW	7	109455121	missense	probably benign	0.25
R7257:Trim66	UTSW	7	109460244	missense	probably damaging	1.00
R7328:Trim66	UTSW	7	109457751	missense	probably damaging	0.99
R7616:Trim66	UTSW	7	109483749	missense	probably damaging	0.99
R8423:Trim66	UTSW	7	109475392	missense	possibly damaging	0.77
R8855:Trim66	UTSW	7	109481981	missense	probably damaging	1.00
R9130:Trim66	UTSW	7	109477689	missense	possibly damaging	0.90
R9137:Trim66	UTSW	7	109475123	missense	probably damaging	0.99
R9640:Trim66	UTSW	7	109475618	missense	probably damaging	1.00
RF013:Trim66	UTSW	7	109460753	missense	probably damaging	0.99
RF024:Trim66	UTSW	7	109460740	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- GCCAGCTATGAGGCAAATCTG -3'
(R):5'- GAAAGGTCACTGTCACATCTCTG -3'

Sequencing Primer
(F):5'- GGCAAATCTGTTATAGAAGCCCTG -3'
(R):5'- TGTCACATCTCTGACTGGGCAG -3'

Posted On

2016-02-04