Incidental Mutation 'R4819:Heca'
ID 370061
Institutional Source Beutler Lab
Gene Symbol Heca
Ensembl Gene ENSMUSG00000039879
Gene Name hdc homolog, cell cycle regulator
Synonyms LOC380629
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock # R4819 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 17868612-17948067 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 17908072 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 478 (Y478H)
Ref Sequence ENSEMBL: ENSMUSP00000040707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037879]
AlphaFold Q3V1N5
Predicted Effect probably damaging
Transcript: ENSMUST00000037879
AA Change: Y478H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040707
Gene: ENSMUSG00000039879
AA Change: Y478H

DomainStartEndE-ValueType
SCOP:d1gkub1 29 61 8e-3 SMART
Pfam:HECA 94 192 2.8e-42 PFAM
Pfam:Headcase 335 535 2.8e-86 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000217949
AA Change: Y116H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218268
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218758
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila headcase protein, a highly basic, cytoplasmic protein that regulates the re-entry of imaginal cells into the mitotic cycle during adult morphogenesis. In Drosophila, the encoded protein also inhibits terminal branching of neighboring cells during tracheal development. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Heca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01544:Heca APN 10 17915967 missense probably damaging 1.00
IGL01971:Heca APN 10 17915414 missense probably damaging 1.00
E0374:Heca UTSW 10 17908176 missense probably damaging 1.00
R0089:Heca UTSW 10 17908100 missense probably damaging 0.99
R0218:Heca UTSW 10 17915715 missense probably benign 0.22
R0608:Heca UTSW 10 17915291 missense possibly damaging 0.86
R4131:Heca UTSW 10 17902239 missense probably damaging 1.00
R4132:Heca UTSW 10 17902239 missense probably damaging 1.00
R4674:Heca UTSW 10 17915309 missense probably benign 0.30
R4675:Heca UTSW 10 17915309 missense probably benign 0.30
R4736:Heca UTSW 10 17915187 nonsense probably null
R4789:Heca UTSW 10 17908147 nonsense probably null
R5372:Heca UTSW 10 17915139 missense probably damaging 1.00
R5412:Heca UTSW 10 17902296 missense probably damaging 1.00
R5737:Heca UTSW 10 17915714 missense possibly damaging 0.76
R6321:Heca UTSW 10 17915243 splice site probably null
R6630:Heca UTSW 10 17908108 nonsense probably null
R7100:Heca UTSW 10 17915373 missense probably benign 0.00
R7381:Heca UTSW 10 17915524 nonsense probably null
R7664:Heca UTSW 10 17902370 missense probably damaging 1.00
R8293:Heca UTSW 10 17902263 missense probably damaging 1.00
R8677:Heca UTSW 10 17915676 missense probably benign 0.10
R8967:Heca UTSW 10 17914990 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTTAGACGGACACCATGACC -3'
(R):5'- TCTGGGCTGTCGATACCAAG -3'

Sequencing Primer
(F):5'- TTAGACGGACACCATGACCAAACC -3'
(R):5'- ATGGGGGCTTTTTATCAGCAC -3'
Posted On 2016-02-04