Incidental Mutation 'R4819:Efs'
ID 370074
Institutional Source Beutler Lab
Gene Symbol Efs
Ensembl Gene ENSMUSG00000022203
Gene Name embryonal Fyn-associated substrate
Synonyms
MMRRC Submission 042000-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R4819 (G1)
Quality Score 91
Status Not validated
Chromosome 14
Chromosomal Location 54916535-54926126 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 54917153 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 450 (E450G)
Ref Sequence ENSEMBL: ENSMUSP00000154657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022813] [ENSMUST00000050772] [ENSMUST00000227037] [ENSMUST00000227587] [ENSMUST00000227880] [ENSMUST00000228119] [ENSMUST00000228495] [ENSMUST00000228588] [ENSMUST00000231305]
AlphaFold Q64355
Predicted Effect probably damaging
Transcript: ENSMUST00000022813
AA Change: E543G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022813
Gene: ENSMUSG00000022203
AA Change: E543G

DomainStartEndE-ValueType
SH3 8 67 5.15e-19 SMART
low complexity region 201 215 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 305 325 N/A INTRINSIC
low complexity region 335 351 N/A INTRINSIC
Pfam:DUF3513 370 555 9.2e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000050772
SMART Domains Protein: ENSMUSP00000049676
Gene: ENSMUSG00000022199

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 370 1.8e-17 PFAM
Pfam:MFS_1 211 394 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226467
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226718
Predicted Effect probably damaging
Transcript: ENSMUST00000227037
AA Change: E450G

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000227587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227600
Predicted Effect probably benign
Transcript: ENSMUST00000227880
Predicted Effect probably benign
Transcript: ENSMUST00000228119
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228249
Predicted Effect probably benign
Transcript: ENSMUST00000228495
Predicted Effect probably benign
Transcript: ENSMUST00000228588
Predicted Effect probably benign
Transcript: ENSMUST00000231305
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The longest protein isoform encoded by this gene contains an SH3 domain, which is known to be important in intracellular signal transduction. The protein encoded by a similiar gene in mice was shown to bind to SH3 domains of protein-tyrosine kinases. The function of this gene is unknown. Three alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a disruption in this gene display an increased inflammatory response characterized by excessive T cell responses, enhanced cytokine secretion and antibody production, and intestinal, kidney, liver, and lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Efs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02176:Efs APN 14 54921042 missense probably damaging 1.00
IGL02720:Efs APN 14 54919715 missense probably damaging 1.00
IGL02752:Efs APN 14 54917423 missense probably damaging 0.96
R0129:Efs UTSW 14 54917223 missense probably damaging 1.00
R1522:Efs UTSW 14 54919715 missense probably damaging 1.00
R1927:Efs UTSW 14 54917163 missense possibly damaging 0.89
R2327:Efs UTSW 14 54917504 missense probably benign 0.01
R3431:Efs UTSW 14 54920224 missense probably damaging 1.00
R3432:Efs UTSW 14 54920224 missense probably damaging 1.00
R3615:Efs UTSW 14 54920095 missense probably damaging 1.00
R3616:Efs UTSW 14 54920095 missense probably damaging 1.00
R3756:Efs UTSW 14 54920422 splice site probably benign
R3945:Efs UTSW 14 54920651 splice site probably benign
R4448:Efs UTSW 14 54920192 missense probably damaging 1.00
R4717:Efs UTSW 14 54920344 missense probably damaging 0.99
R5656:Efs UTSW 14 54917127 missense probably damaging 1.00
R5946:Efs UTSW 14 54919494 splice site probably null
R6054:Efs UTSW 14 54921157 missense probably damaging 1.00
R7457:Efs UTSW 14 54919994 missense probably benign
R7822:Efs UTSW 14 54917450 missense probably benign 0.09
R7970:Efs UTSW 14 54920503 critical splice donor site probably null
R8166:Efs UTSW 14 54920620 missense probably damaging 1.00
R8347:Efs UTSW 14 54919784 missense probably benign 0.28
R8896:Efs UTSW 14 54920299 missense possibly damaging 0.80
R9438:Efs UTSW 14 54919411 missense
R9703:Efs UTSW 14 54919414 missense possibly damaging 0.88
X0028:Efs UTSW 14 54920621 nonsense probably null
Z1176:Efs UTSW 14 54920336 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGATGCCTGCCTGGACAAAG -3'
(R):5'- GTTTGTTGGAGACACCCTAGG -3'

Sequencing Primer
(F):5'- TGGCTCATACAAAAGGCAGTAG -3'
(R):5'- AGACACCCTAGGCCGGC -3'
Posted On 2016-02-04