Incidental Mutation 'R4819:Khsrp'
ID370081
Institutional Source Beutler Lab
Gene Symbol Khsrp
Ensembl Gene ENSMUSG00000007670
Gene NameKH-type splicing regulatory protein
Synonyms6330409F21Rik, KSRP
MMRRC Submission 042000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4819 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57021058-57031507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57023360 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 582 (S582P)
Ref Sequence ENSEMBL: ENSMUSP00000007814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007814] [ENSMUST00000210548]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007814
AA Change: S582P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000007814
Gene: ENSMUSG00000007670
AA Change: S582P

DomainStartEndE-ValueType
low complexity region 7 69 N/A INTRINSIC
KH 144 214 1.46e-18 SMART
KH 233 305 2.46e-16 SMART
KH 322 392 7.87e-15 SMART
KH 424 497 3.29e-17 SMART
low complexity region 498 547 N/A INTRINSIC
low complexity region 557 579 N/A INTRINSIC
Pfam:DUF1897 610 636 1.8e-8 PFAM
Pfam:DUF1897 666 688 8.5e-10 PFAM
low complexity region 691 710 N/A INTRINSIC
low complexity region 717 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210548
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KHSRP gene encodes a multifunctional RNA-binding protein implicated in a variety of cellular processes, including transcription, alternative pre-mRNA splicing, and mRNA localization (Min et al., 1997 [PubMed 9136930]; Gherzi et al., 2004 [PubMed 15175153]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to HSV-1 infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Greb1l A G 18: 10,458,358 D45G probably damaging Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Khsrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Khsrp APN 17 57023092 missense possibly damaging 0.49
R0973:Khsrp UTSW 17 57025576 missense probably benign
R0973:Khsrp UTSW 17 57025576 missense probably benign
R0974:Khsrp UTSW 17 57025576 missense probably benign
R0975:Khsrp UTSW 17 57027066 missense possibly damaging 0.68
R1080:Khsrp UTSW 17 57024410 frame shift probably null
R1561:Khsrp UTSW 17 57025639 missense probably benign 0.01
R1686:Khsrp UTSW 17 57025597 missense probably benign 0.32
R2133:Khsrp UTSW 17 57027832 missense probably benign 0.17
R2134:Khsrp UTSW 17 57024410 frame shift probably null
R4133:Khsrp UTSW 17 57025605 missense probably benign 0.00
R5213:Khsrp UTSW 17 57024366 missense probably benign 0.17
R5372:Khsrp UTSW 17 57024292 missense possibly damaging 0.95
R6246:Khsrp UTSW 17 57025324 missense possibly damaging 0.45
R6528:Khsrp UTSW 17 57023543 missense probably damaging 0.99
R7071:Khsrp UTSW 17 57025386 missense possibly damaging 0.55
R7141:Khsrp UTSW 17 57025602 missense possibly damaging 0.85
R8282:Khsrp UTSW 17 57024123 missense probably damaging 0.98
Z1088:Khsrp UTSW 17 57024249 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCTTCCCAGCACTGAACTTACC -3'
(R):5'- GAACCAGTTCTCATGGCCAC -3'

Sequencing Primer
(F):5'- GTGTAGTCTGATTGGCCA -3'
(R):5'- AGGGCTGGGGCAATACCTAC -3'
Posted On2016-02-04