Incidental Mutation 'R4819:Greb1l'
ID 370083
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Name growth regulation by estrogen in breast cancer-like
Synonyms AK220484, mKIAA4095
MMRRC Submission 042000-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Essential gene? Essential (E-score: 1.000) question?
Stock # R4819 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 10325177-10562934 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10458358 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 45 (D45G)
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]
AlphaFold B9EJV3
Predicted Effect possibly damaging
Transcript: ENSMUST00000048977
AA Change: D45G

PolyPhen 2 Score 0.503 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: D45G

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172532
AA Change: D45G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: D45G

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173356
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,290,421 N761K possibly damaging Het
Adgrf3 T A 5: 30,198,444 L444F possibly damaging Het
Akap8 G A 17: 32,312,305 R378W probably damaging Het
Amotl2 C T 9: 102,730,071 R693W probably damaging Het
As3mt G T 19: 46,707,529 probably benign Het
Atp6v1e2 A G 17: 86,944,538 V144A probably benign Het
Bfar C T 16: 13,687,467 Q114* probably null Het
Casd1 C T 6: 4,621,225 A261V probably damaging Het
Ccdc36 A G 9: 108,406,678 V189A probably benign Het
Cd177 A T 7: 24,752,271 I440K probably damaging Het
Cfap54 G T 10: 92,836,477 Y2910* probably null Het
Csl A G 10: 99,758,082 F374L possibly damaging Het
Dctn1 G A 6: 83,190,519 R275H probably damaging Het
Derl3 A G 10: 75,893,879 probably null Het
Dst A G 1: 33,968,835 I117V probably benign Het
Edc3 T A 9: 57,748,397 C477S possibly damaging Het
Efs T C 14: 54,917,153 E450G probably damaging Het
Fcrla T A 1: 170,920,939 I212F probably damaging Het
Fsip2 A G 2: 82,988,442 I4840V probably benign Het
Gm14025 G T 2: 129,040,801 N98K probably damaging Het
Gpam T A 19: 55,078,341 I581F probably benign Het
Heca A G 10: 17,908,072 Y478H probably damaging Het
Hspa9 C T 18: 34,939,388 M561I probably damaging Het
Hyal6 T A 6: 24,734,966 Y299* probably null Het
Ik T A 18: 36,753,257 probably null Het
Khsrp A G 17: 57,023,360 S582P possibly damaging Het
Kif18a A G 2: 109,292,126 D182G probably damaging Het
Krt2 T C 15: 101,811,544 T564A unknown Het
Lig4 A G 8: 9,971,885 S632P probably benign Het
Med1 C T 11: 98,155,432 probably benign Het
Mgat3 T A 15: 80,212,349 I459N probably damaging Het
Mkln1 A T 6: 31,474,486 Q454L probably benign Het
Mn1 A G 5: 111,419,937 E591G possibly damaging Het
Myo5c T A 9: 75,292,202 L1364Q probably damaging Het
Oas1d T C 5: 120,915,717 V80A probably damaging Het
Obscn A T 11: 59,038,848 D5180E probably damaging Het
Pax6 G A 2: 105,692,277 probably null Het
Pcdh15 A C 10: 74,324,389 N446T probably damaging Het
Pcnx2 A T 8: 125,855,230 F922L probably benign Het
Ptpn4 G T 1: 119,659,850 T921K probably benign Het
Selenov A G 7: 28,290,321 probably null Het
Tmem100 A G 11: 90,035,445 T33A probably benign Het
Tmem59 C T 4: 107,187,681 Q66* probably null Het
Trav21-dv12 T A 14: 53,876,613 Y63* probably null Het
Trim66 G T 7: 109,457,586 H1121Q probably damaging Het
Trim80 A G 11: 115,447,943 Y533C probably damaging Het
Ttc17 G A 2: 94,364,610 P520L probably damaging Het
Ttn A T 2: 76,791,749 V15483E probably damaging Het
Zdhhc1 CGGGGG CGGGGGG 8: 105,483,744 probably null Het
Zfhx4 C A 3: 5,403,914 T3069K probably benign Het
Zfp281 A G 1: 136,625,710 H142R probably benign Het
Zfp462 G T 4: 55,060,044 R1190L probably damaging Het
Zfp935 T A 13: 62,454,417 H323L probably damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10,555,962 (GRCm38) missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10,522,144 (GRCm38) missense probably benign 0.01
IGL01563:Greb1l APN 18 10,469,399 (GRCm38) missense probably damaging 0.99
IGL01944:Greb1l APN 18 10,557,280 (GRCm38) missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10,515,271 (GRCm38) missense probably damaging 1.00
IGL02249:Greb1l APN 18 10,532,961 (GRCm38) missense probably damaging 1.00
IGL02318:Greb1l APN 18 10,469,388 (GRCm38) missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10,515,200 (GRCm38) missense probably damaging 0.99
IGL02516:Greb1l APN 18 10,537,064 (GRCm38) missense probably benign 0.31
IGL02566:Greb1l APN 18 10,503,299 (GRCm38) missense probably damaging 0.99
IGL02583:Greb1l APN 18 10,542,362 (GRCm38) missense probably damaging 1.00
IGL02838:Greb1l APN 18 10,560,430 (GRCm38) missense probably damaging 1.00
A4554:Greb1l UTSW 18 10,532,862 (GRCm38) missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10,533,032 (GRCm38) missense probably benign 0.08
PIT4453001:Greb1l UTSW 18 10,533,031 (GRCm38) missense probably damaging 0.98
R0099:Greb1l UTSW 18 10,509,158 (GRCm38) missense probably damaging 1.00
R0226:Greb1l UTSW 18 10,522,076 (GRCm38) intron probably benign
R0234:Greb1l UTSW 18 10,560,331 (GRCm38) missense probably damaging 1.00
R0234:Greb1l UTSW 18 10,560,331 (GRCm38) missense probably damaging 1.00
R0239:Greb1l UTSW 18 10,458,567 (GRCm38) splice site probably benign
R0316:Greb1l UTSW 18 10,547,420 (GRCm38) missense probably damaging 1.00
R0369:Greb1l UTSW 18 10,469,375 (GRCm38) missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10,523,374 (GRCm38) missense probably damaging 0.99
R0478:Greb1l UTSW 18 10,509,281 (GRCm38) missense probably damaging 1.00
R0555:Greb1l UTSW 18 10,458,781 (GRCm38) splice site probably benign
R0671:Greb1l UTSW 18 10,474,303 (GRCm38) missense probably damaging 1.00
R1282:Greb1l UTSW 18 10,547,289 (GRCm38) missense probably benign 0.13
R1574:Greb1l UTSW 18 10,554,997 (GRCm38) missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10,554,997 (GRCm38) missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10,529,703 (GRCm38) missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10,529,708 (GRCm38) critical splice donor site probably null
R1666:Greb1l UTSW 18 10,501,080 (GRCm38) critical splice donor site probably null
R1720:Greb1l UTSW 18 10,553,848 (GRCm38) missense probably benign 0.19
R1808:Greb1l UTSW 18 10,542,143 (GRCm38) missense probably benign
R1829:Greb1l UTSW 18 10,509,314 (GRCm38) missense probably damaging 1.00
R1897:Greb1l UTSW 18 10,498,992 (GRCm38) missense probably benign 0.00
R1967:Greb1l UTSW 18 10,501,049 (GRCm38) missense possibly damaging 0.91
R2025:Greb1l UTSW 18 10,515,221 (GRCm38) missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10,523,281 (GRCm38) missense probably damaging 1.00
R2125:Greb1l UTSW 18 10,511,422 (GRCm38) missense probably damaging 0.98
R2139:Greb1l UTSW 18 10,555,011 (GRCm38) missense probably damaging 1.00
R2255:Greb1l UTSW 18 10,554,857 (GRCm38) missense probably damaging 1.00
R2256:Greb1l UTSW 18 10,503,307 (GRCm38) missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10,503,307 (GRCm38) missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10,547,288 (GRCm38) missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10,542,380 (GRCm38) missense probably damaging 0.99
R3778:Greb1l UTSW 18 10,469,444 (GRCm38) missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10,522,247 (GRCm38) missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10,515,209 (GRCm38) missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10,522,150 (GRCm38) missense probably damaging 0.99
R4134:Greb1l UTSW 18 10,529,708 (GRCm38) critical splice donor site probably null
R4342:Greb1l UTSW 18 10,544,561 (GRCm38) missense probably benign 0.12
R4409:Greb1l UTSW 18 10,503,182 (GRCm38) missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10,553,705 (GRCm38) missense probably damaging 1.00
R4618:Greb1l UTSW 18 10,498,965 (GRCm38) missense probably benign 0.00
R4683:Greb1l UTSW 18 10,529,563 (GRCm38) splice site probably null
R4686:Greb1l UTSW 18 10,522,112 (GRCm38) missense probably damaging 0.98
R4707:Greb1l UTSW 18 10,532,922 (GRCm38) missense probably benign 0.02
R4780:Greb1l UTSW 18 10,541,792 (GRCm38) missense probably benign 0.00
R4925:Greb1l UTSW 18 10,547,447 (GRCm38) missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10,547,306 (GRCm38) missense probably damaging 0.99
R5150:Greb1l UTSW 18 10,555,950 (GRCm38) frame shift probably null
R5154:Greb1l UTSW 18 10,458,312 (GRCm38) missense probably benign 0.02
R5269:Greb1l UTSW 18 10,511,409 (GRCm38) missense probably benign
R5290:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5310:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5328:Greb1l UTSW 18 10,553,720 (GRCm38) missense probably damaging 1.00
R5337:Greb1l UTSW 18 10,509,143 (GRCm38) missense probably damaging 1.00
R5393:Greb1l UTSW 18 10,458,312 (GRCm38) missense probably benign 0.02
R5402:Greb1l UTSW 18 10,537,169 (GRCm38) missense probably benign 0.26
R5718:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5719:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5720:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5721:Greb1l UTSW 18 10,542,427 (GRCm38) missense probably damaging 1.00
R5902:Greb1l UTSW 18 10,538,302 (GRCm38) missense probably benign 0.00
R5993:Greb1l UTSW 18 10,544,455 (GRCm38) missense probably benign 0.10
R6035:Greb1l UTSW 18 10,501,025 (GRCm38) missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10,501,025 (GRCm38) missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10,547,068 (GRCm38) missense probably damaging 1.00
R6063:Greb1l UTSW 18 10,557,340 (GRCm38) missense probably damaging 1.00
R6297:Greb1l UTSW 18 10,469,494 (GRCm38) missense probably damaging 1.00
R6405:Greb1l UTSW 18 10,501,076 (GRCm38) missense probably benign 0.30
R6552:Greb1l UTSW 18 10,541,814 (GRCm38) missense probably benign 0.00
R6572:Greb1l UTSW 18 10,522,131 (GRCm38) missense probably benign 0.07
R6575:Greb1l UTSW 18 10,547,347 (GRCm38) missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10,547,482 (GRCm38) missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10,558,786 (GRCm38) missense probably benign 0.23
R6962:Greb1l UTSW 18 10,547,327 (GRCm38) missense probably damaging 1.00
R7012:Greb1l UTSW 18 10,529,707 (GRCm38) critical splice donor site probably null
R7179:Greb1l UTSW 18 10,544,576 (GRCm38) missense probably benign 0.00
R7251:Greb1l UTSW 18 10,515,319 (GRCm38) missense probably damaging 1.00
R7275:Greb1l UTSW 18 10,544,561 (GRCm38) missense probably benign 0.12
R7301:Greb1l UTSW 18 10,544,970 (GRCm38) missense probably damaging 1.00
R7307:Greb1l UTSW 18 10,538,142 (GRCm38) missense probably damaging 0.99
R7455:Greb1l UTSW 18 10,554,915 (GRCm38) missense probably damaging 1.00
R7832:Greb1l UTSW 18 10,542,056 (GRCm38) missense probably benign 0.38
R7934:Greb1l UTSW 18 10,474,371 (GRCm38) nonsense probably null
R8137:Greb1l UTSW 18 10,474,357 (GRCm38) missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10,533,060 (GRCm38) missense probably benign 0.13
R8208:Greb1l UTSW 18 10,510,703 (GRCm38) missense probably damaging 1.00
R8227:Greb1l UTSW 18 10,515,371 (GRCm38) missense probably damaging 1.00
R8312:Greb1l UTSW 18 10,511,587 (GRCm38) intron probably benign
R8331:Greb1l UTSW 18 10,458,706 (GRCm38) missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10,529,687 (GRCm38) missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10,529,613 (GRCm38) missense probably benign 0.00
R8695:Greb1l UTSW 18 10,544,450 (GRCm38) missense probably benign 0.01
R8795:Greb1l UTSW 18 10,553,739 (GRCm38) missense probably damaging 0.98
R8836:Greb1l UTSW 18 10,509,257 (GRCm38) missense probably benign 0.30
R8862:Greb1l UTSW 18 10,555,042 (GRCm38) missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10,529,684 (GRCm38) missense probably benign 0.18
R8874:Greb1l UTSW 18 10,544,896 (GRCm38) missense probably benign 0.01
R8886:Greb1l UTSW 18 10,553,843 (GRCm38) missense probably benign 0.21
R8921:Greb1l UTSW 18 10,541,825 (GRCm38) missense probably benign 0.01
R8997:Greb1l UTSW 18 10,510,747 (GRCm38) missense probably damaging 1.00
R9015:Greb1l UTSW 18 10,541,675 (GRCm38) missense probably benign 0.00
R9018:Greb1l UTSW 18 10,542,004 (GRCm38) missense possibly damaging 0.76
R9074:Greb1l UTSW 18 10,558,795 (GRCm38) missense probably damaging 1.00
R9074:Greb1l UTSW 18 10,532,797 (GRCm38) missense probably damaging 1.00
R9117:Greb1l UTSW 18 10,542,422 (GRCm38) missense probably benign 0.31
R9189:Greb1l UTSW 18 10,499,983 (GRCm38) missense probably benign
R9332:Greb1l UTSW 18 10,532,796 (GRCm38) missense possibly damaging 0.92
R9367:Greb1l UTSW 18 10,522,130 (GRCm38) missense probably benign 0.00
R9497:Greb1l UTSW 18 10,458,600 (GRCm38) missense probably benign 0.00
R9796:Greb1l UTSW 18 10,538,233 (GRCm38) missense possibly damaging 0.69
Z1176:Greb1l UTSW 18 10,515,305 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTCTGGACAAAGGCCAC -3'
(R):5'- TCTGTTTAAACGAGGAAACCAATGC -3'

Sequencing Primer
(F):5'- GTTTTCAGAAGAGGTCCAGATCCC -3'
(R):5'- GGGGGAGACTAGCATTTT -3'
Posted On 2016-02-04