Incidental Mutation 'R4820:Cfap65'
ID 370088
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Name cilia and flagella associated protein 65
Synonyms Ccdc108, B230363K08Rik
MMRRC Submission 042436-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.720) question?
Stock # R4820 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 74941230-74974758 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 74966791 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 299 (A299T)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
AlphaFold Q3V0B4
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: A299T

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: A299T

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130489
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139950
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency 96% (104/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930488N24Rik T C 17: 14,326,481 (GRCm39) noncoding transcript Het
5730455P16Rik A T 11: 80,266,346 (GRCm39) S132T possibly damaging Het
Aadacl3 T A 4: 144,184,527 (GRCm39) H77L probably damaging Het
Actr5 T A 2: 158,467,426 (GRCm39) V122D probably damaging Het
Adamts7 A G 9: 90,071,739 (GRCm39) D678G possibly damaging Het
Alpk1 T A 3: 127,464,708 (GRCm39) D1190V probably benign Het
Apbb1ip A T 2: 22,765,265 (GRCm39) N649Y unknown Het
Atp6v0a1 A G 11: 100,933,776 (GRCm39) I522V probably benign Het
Brd10 T C 19: 29,695,809 (GRCm39) N1228S possibly damaging Het
Cars1 T C 7: 143,124,301 (GRCm39) D375G probably damaging Het
Catspere1 A T 1: 177,687,441 (GRCm39) noncoding transcript Het
Ccdc87 A G 19: 4,890,579 (GRCm39) D357G probably damaging Het
Cd101 A T 3: 100,929,471 (GRCm39) S8T probably benign Het
Cic T C 7: 24,971,157 (GRCm39) V296A possibly damaging Het
Col7a1 T A 9: 108,797,675 (GRCm39) S1686T possibly damaging Het
Ctbp2 A C 7: 132,615,423 (GRCm39) L504R probably damaging Het
Cttnbp2nl T C 3: 104,918,640 (GRCm39) K67E probably benign Het
Cyp2c50 C T 19: 40,102,024 (GRCm39) P480S probably damaging Het
Dcdc5 A C 2: 106,166,420 (GRCm39) noncoding transcript Het
Defb2 G T 8: 22,333,317 (GRCm39) E31* probably null Het
Dhrs1 T A 14: 55,977,083 (GRCm39) N244I possibly damaging Het
Dop1b A G 16: 93,589,978 (GRCm39) I134V probably benign Het
Eif1ad11 A T 12: 87,994,158 (GRCm39) I129F unknown Het
Etl4 A G 2: 20,811,496 (GRCm39) D1193G possibly damaging Het
Ezh1 A C 11: 101,094,594 (GRCm39) S399R probably damaging Het
Fam161a T C 11: 22,970,076 (GRCm39) S26P probably damaging Het
Fcgbp C A 7: 27,813,383 (GRCm39) S2306Y probably damaging Het
Fras1 T C 5: 96,876,512 (GRCm39) I2415T probably benign Het
Gas2l3 A G 10: 89,252,907 (GRCm39) L246P probably damaging Het
Gdf15 C T 8: 71,082,246 (GRCm39) V287M probably damaging Het
Gm7742 T C 17: 21,420,235 (GRCm39) noncoding transcript Het
Grin2d T C 7: 45,507,363 (GRCm39) D446G probably damaging Het
Hemk1 A G 9: 107,205,385 (GRCm39) F107L probably benign Het
Hmgcr C T 13: 96,796,700 (GRCm39) G197S probably damaging Het
Ift52 G A 2: 162,873,108 (GRCm39) G207D probably benign Het
Il17re A G 6: 113,442,816 (GRCm39) T275A probably benign Het
Iqcf3 T C 9: 106,430,788 (GRCm39) probably benign Het
Kcna1 A G 6: 126,619,099 (GRCm39) I407T probably damaging Het
Kcnrg T A 14: 61,845,386 (GRCm39) M142K probably benign Het
Lhx9 C A 1: 138,766,105 (GRCm39) V237L probably benign Het
Lipo3 A C 19: 33,560,497 (GRCm39) I56S probably damaging Het
Loxhd1 C G 18: 77,472,663 (GRCm39) P1060R probably damaging Het
Map2k4 A C 11: 65,587,201 (GRCm39) probably benign Het
Methig1 A G 15: 100,251,416 (GRCm39) K109R possibly damaging Het
Mmrn1 G A 6: 60,950,027 (GRCm39) V326I probably benign Het
Myo15a G A 11: 60,367,741 (GRCm39) R167H probably damaging Het
Ncoa7 G A 10: 30,524,472 (GRCm39) T142M probably damaging Het
Nfkb2 C A 19: 46,296,493 (GRCm39) Q254K probably damaging Het
Nherf1 A G 11: 115,070,918 (GRCm39) E290G probably benign Het
Nol6 G T 4: 41,121,508 (GRCm39) P278Q probably damaging Het
Nptxr T A 15: 79,677,027 (GRCm39) D285V probably damaging Het
Oosp3 T C 19: 11,688,997 (GRCm39) W82R probably damaging Het
Or6b3 A T 1: 92,438,812 (GRCm39) *313K probably null Het
Or6n1 A G 1: 173,916,742 (GRCm39) I45M possibly damaging Het
Pa2g4 G T 10: 128,395,199 (GRCm39) T322K probably damaging Het
Parp16 C A 9: 65,145,175 (GRCm39) F291L probably damaging Het
Pdzd9 A T 7: 120,267,619 (GRCm39) D65E probably damaging Het
Pgap3 A G 11: 98,281,300 (GRCm39) W238R probably damaging Het
Pgf G A 12: 85,218,538 (GRCm39) H67Y probably benign Het
Pik3cb T C 9: 98,955,679 (GRCm39) T413A probably benign Het
Plcxd2 A T 16: 45,800,700 (GRCm39) C175S probably benign Het
Pou2f1 A T 1: 165,719,517 (GRCm39) probably benign Het
Ppfia1 T G 7: 144,052,106 (GRCm39) N846T probably benign Het
Ppid T A 3: 79,502,504 (GRCm39) probably null Het
Prkcq G A 2: 11,231,797 (GRCm39) probably null Het
Ptgds T C 2: 25,359,058 (GRCm39) K66E probably benign Het
Ptpmt1 A G 2: 90,748,283 (GRCm39) noncoding transcript Het
Rab3il1 G A 19: 10,004,034 (GRCm39) G51D probably benign Het
Rdx T C 9: 51,974,891 (GRCm39) V9A probably damaging Het
Rpl7l1 T C 17: 47,089,014 (GRCm39) N239S probably benign Het
Rrbp1 C A 2: 143,806,685 (GRCm39) A978S possibly damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGCCGGCGGCG 7: 97,229,126 (GRCm39) probably benign Het
Scn3a A T 2: 65,291,622 (GRCm39) I1708N probably damaging Het
Serinc1 A G 10: 57,401,466 (GRCm39) I109T possibly damaging Het
Shroom1 G A 11: 53,355,966 (GRCm39) V339I probably benign Het
Slc30a8 T A 15: 52,169,880 (GRCm39) C36S probably benign Het
Slco1b2 A G 6: 141,631,158 (GRCm39) I597M probably benign Het
Snx27 A G 3: 94,427,518 (GRCm39) F228S probably damaging Het
Spata31f1a T A 4: 42,851,815 (GRCm39) I114F probably damaging Het
Speer4e2 G T 5: 15,026,225 (GRCm39) T144K probably benign Het
Stim1 T A 7: 102,064,571 (GRCm39) F214I probably damaging Het
Svep1 T C 4: 58,082,664 (GRCm39) T1987A probably benign Het
Tamm41 A G 6: 115,002,378 (GRCm39) I18T possibly damaging Het
Tmem150b T A 7: 4,726,871 (GRCm39) D79V probably damaging Het
Tmem167 T A 13: 90,252,548 (GRCm39) I68N probably benign Het
Traf3 A G 12: 111,227,204 (GRCm39) E339G possibly damaging Het
Tspan12 G A 6: 21,795,660 (GRCm39) P177S probably damaging Het
Ttn A G 2: 76,783,562 (GRCm39) I810T probably benign Het
Ulk1 T C 5: 110,939,996 (GRCm39) T407A probably benign Het
Uroc1 G A 6: 90,334,600 (GRCm39) probably null Het
Vmn2r-ps69 T C 7: 84,959,584 (GRCm39) noncoding transcript Het
Wdr59 T C 8: 112,207,446 (GRCm39) N476S probably benign Het
Zfp472 A G 17: 33,196,416 (GRCm39) M164V probably benign Het
Zfp608 T C 18: 55,120,756 (GRCm39) N277S probably benign Het
Zfp831 T C 2: 174,547,097 (GRCm39) C1427R possibly damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74,958,342 (GRCm39) critical splice donor site probably null
IGL01526:Cfap65 APN 1 74,950,237 (GRCm39) missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74,966,353 (GRCm39) missense probably benign
IGL01780:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL01993:Cfap65 APN 1 74,959,702 (GRCm39) missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74,967,304 (GRCm39) missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02357:Cfap65 APN 1 74,967,507 (GRCm39) nonsense probably null
IGL02576:Cfap65 APN 1 74,942,617 (GRCm39) missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74,944,239 (GRCm39) missense probably benign 0.00
IGL02792:Cfap65 APN 1 74,966,337 (GRCm39) missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74,950,267 (GRCm39) nonsense probably null
IGL03101:Cfap65 APN 1 74,967,592 (GRCm39) missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74,966,778 (GRCm39) missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74,943,801 (GRCm39) missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74,967,501 (GRCm39) missense probably benign 0.05
R0077:Cfap65 UTSW 1 74,971,077 (GRCm39) missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74,971,117 (GRCm39) nonsense probably null
R0281:Cfap65 UTSW 1 74,966,230 (GRCm39) missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74,943,226 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,461 (GRCm39) missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74,968,460 (GRCm39) missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74,965,603 (GRCm39) missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74,959,760 (GRCm39) missense probably benign 0.00
R0361:Cfap65 UTSW 1 74,964,599 (GRCm39) missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74,956,043 (GRCm39) missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74,957,603 (GRCm39) missense probably benign 0.01
R0646:Cfap65 UTSW 1 74,941,328 (GRCm39) missense probably benign 0.09
R0734:Cfap65 UTSW 1 74,958,046 (GRCm39) missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74,943,841 (GRCm39) missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74,960,678 (GRCm39) missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74,944,872 (GRCm39) missense probably damaging 0.99
R1079:Cfap65 UTSW 1 74,941,606 (GRCm39) missense probably damaging 0.98
R1083:Cfap65 UTSW 1 74,957,663 (GRCm39) splice site probably benign
R1159:Cfap65 UTSW 1 74,968,499 (GRCm39) missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74,964,263 (GRCm39) missense probably benign 0.03
R1644:Cfap65 UTSW 1 74,956,334 (GRCm39) missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74,958,107 (GRCm39) missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74,946,819 (GRCm39) missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74,956,358 (GRCm39) missense probably benign 0.30
R2132:Cfap65 UTSW 1 74,946,850 (GRCm39) missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74,956,432 (GRCm39) frame shift probably null
R2219:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74,943,184 (GRCm39) missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74,965,634 (GRCm39) missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74,966,345 (GRCm39) small insertion probably benign
R3114:Cfap65 UTSW 1 74,966,291 (GRCm39) missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74,959,701 (GRCm39) missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74,966,840 (GRCm39) missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74,942,517 (GRCm39) missense probably benign 0.17
R4547:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74,946,771 (GRCm39) missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74,943,215 (GRCm39) missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74,964,513 (GRCm39) intron probably benign
R4701:Cfap65 UTSW 1 74,958,067 (GRCm39) missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74,967,520 (GRCm39) missense probably damaging 1.00
R4831:Cfap65 UTSW 1 74,956,454 (GRCm39) missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74,964,716 (GRCm39) missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74,958,420 (GRCm39) missense probably benign 0.00
R4881:Cfap65 UTSW 1 74,946,772 (GRCm39) missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74,942,283 (GRCm39) missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74,945,495 (GRCm39) nonsense probably null
R5074:Cfap65 UTSW 1 74,962,137 (GRCm39) missense probably benign 0.04
R5083:Cfap65 UTSW 1 74,945,600 (GRCm39) missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74,965,675 (GRCm39) missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74,964,061 (GRCm39) missense probably benign 0.07
R5333:Cfap65 UTSW 1 74,942,334 (GRCm39) missense probably benign 0.03
R5417:Cfap65 UTSW 1 74,964,259 (GRCm39) missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74,946,677 (GRCm39) intron probably benign
R5669:Cfap65 UTSW 1 74,964,127 (GRCm39) missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74,962,190 (GRCm39) missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74,959,564 (GRCm39) missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74,942,298 (GRCm39) missense probably benign 0.14
R6425:Cfap65 UTSW 1 74,966,868 (GRCm39) missense probably benign 0.00
R6677:Cfap65 UTSW 1 74,943,844 (GRCm39) missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74,956,445 (GRCm39) missense probably benign 0.00
R6838:Cfap65 UTSW 1 74,971,180 (GRCm39) missense probably benign 0.06
R6861:Cfap65 UTSW 1 74,964,274 (GRCm39) missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74,971,058 (GRCm39) missense possibly damaging 0.58
R7134:Cfap65 UTSW 1 74,965,792 (GRCm39) missense probably benign 0.01
R7320:Cfap65 UTSW 1 74,965,763 (GRCm39) missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74,960,742 (GRCm39) missense probably benign 0.07
R7426:Cfap65 UTSW 1 74,959,585 (GRCm39) missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74,965,769 (GRCm39) missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74,941,593 (GRCm39) missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74,972,303 (GRCm39) missense probably benign 0.44
R7704:Cfap65 UTSW 1 74,967,527 (GRCm39) missense probably benign 0.19
R7727:Cfap65 UTSW 1 74,965,784 (GRCm39) missense probably benign 0.00
R7895:Cfap65 UTSW 1 74,972,321 (GRCm39) missense probably benign 0.05
R8215:Cfap65 UTSW 1 74,949,902 (GRCm39) missense probably damaging 1.00
R8344:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8345:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8413:Cfap65 UTSW 1 74,956,328 (GRCm39) nonsense probably null
R8431:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8432:Cfap65 UTSW 1 74,967,203 (GRCm39) missense probably benign 0.01
R8528:Cfap65 UTSW 1 74,945,096 (GRCm39) missense possibly damaging 0.88
R8809:Cfap65 UTSW 1 74,942,382 (GRCm39) missense probably benign 0.43
R8996:Cfap65 UTSW 1 74,941,347 (GRCm39) missense probably benign 0.11
R9020:Cfap65 UTSW 1 74,959,552 (GRCm39) missense probably damaging 1.00
R9043:Cfap65 UTSW 1 74,943,847 (GRCm39) missense possibly damaging 0.88
R9127:Cfap65 UTSW 1 74,958,510 (GRCm39) splice site probably benign
R9187:Cfap65 UTSW 1 74,956,517 (GRCm39) missense probably benign 0.00
R9210:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9212:Cfap65 UTSW 1 74,959,567 (GRCm39) missense probably benign
R9273:Cfap65 UTSW 1 74,960,769 (GRCm39) missense probably benign 0.00
R9454:Cfap65 UTSW 1 74,944,210 (GRCm39) missense probably damaging 1.00
R9514:Cfap65 UTSW 1 74,945,468 (GRCm39) critical splice donor site probably null
R9595:Cfap65 UTSW 1 74,946,537 (GRCm39) missense probably damaging 1.00
R9721:Cfap65 UTSW 1 74,958,501 (GRCm39) missense probably benign 0.16
R9742:Cfap65 UTSW 1 74,943,840 (GRCm39) missense probably benign 0.08
RF009:Cfap65 UTSW 1 74,944,806 (GRCm39) missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74,949,906 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCCAAAGGTAGTATGAGAGC -3'
(R):5'- ATACACGGTCTTGTAGGGACTG -3'

Sequencing Primer
(F):5'- CCCAAAGGTAGTATGAGAGCTAGCC -3'
(R):5'- GACTGTTCAGCTGGGGC -3'
Posted On 2016-02-04