Incidental Mutation 'R0420:Pgbd1'
ID37012
Institutional Source Beutler Lab
Gene Symbol Pgbd1
Ensembl Gene ENSMUSG00000055313
Gene NamepiggyBac transposable element derived 1
Synonyms4921509E05Rik
MMRRC Submission 038622-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0420 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location21421275-21441058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 21423166 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 286 (V286E)
Ref Sequence ENSEMBL: ENSMUSP00000117669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099719] [ENSMUST00000122872] [ENSMUST00000145494] [ENSMUST00000148071] [ENSMUST00000151743]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099719
AA Change: V286E

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097307
Gene: ENSMUSG00000055313
AA Change: V286E

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.1e-45 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122872
AA Change: V249E

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120175
Gene: ENSMUSG00000055313
AA Change: V249E

DomainStartEndE-ValueType
Blast:SCAN 1 65 1e-13 BLAST
low complexity region 155 167 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 213 374 1.4e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145494
SMART Domains Protein: ENSMUSP00000118503
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 8e-15 BLAST
low complexity region 192 204 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000148071
SMART Domains Protein: ENSMUSP00000114882
Gene: ENSMUSG00000055313

DomainStartEndE-ValueType
Blast:SCAN 1 65 3e-16 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000151743
AA Change: V286E

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117669
Gene: ENSMUSG00000055313
AA Change: V286E

DomainStartEndE-ValueType
Blast:SCAN 1 65 7e-14 BLAST
low complexity region 192 204 N/A INTRINSIC
Pfam:DDE_Tnp_1_7 250 411 1.7e-42 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The piggyBac family of proteins, found in diverse animals, are transposases related to the transposase of the canonical piggyBac transposon from the moth, Trichoplusia ni. This family also includes genes in several genomes, including human, that appear to have been derived from the piggyBac transposons. This gene belongs to the subfamily of piggyBac transposable element derived (PGBD) genes. The PGBD proteins appear to be novel, with no obvious relationship to other transposases, or other known protein families. This gene product is specifically expressed in the brain, however, its exact function is not known. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,571,094 S17G probably benign Het
Abcb4 T C 5: 8,941,050 V870A probably benign Het
Adam6b A T 12: 113,489,994 M144L probably benign Het
Adrb2 T A 18: 62,179,539 I72L possibly damaging Het
Ankrd53 A T 6: 83,763,692 H99L probably damaging Het
Ap4e1 C T 2: 127,049,360 T17M probably damaging Het
Arnt T A 3: 95,470,394 probably benign Het
Atp1a3 C T 7: 24,980,627 G884E probably benign Het
Atp6v1b1 T C 6: 83,752,844 probably benign Het
Atp8a2 G T 14: 59,773,744 T971K probably damaging Het
BC048562 A T 9: 108,445,966 T167S probably benign Het
Brd9 A G 13: 73,955,473 M491V probably benign Het
Btnl10 A T 11: 58,923,451 D319V probably damaging Het
Cadps T A 14: 12,491,800 R783S probably damaging Het
Ccdc149 A G 5: 52,400,239 probably benign Het
Ccm2l A T 2: 153,070,862 D107V probably null Het
Cep192 A G 18: 67,813,893 E213G possibly damaging Het
Cyp2c37 A C 19: 39,995,794 N242T probably benign Het
Dnah17 A G 11: 118,039,939 V3750A probably damaging Het
Ehbp1 T A 11: 22,151,836 I231L probably benign Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eya4 T C 10: 23,155,963 N254S possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Fancd2 T C 6: 113,536,979 L108P probably damaging Het
Fgf12 A T 16: 28,162,529 M145K possibly damaging Het
Gabbr1 A G 17: 37,046,762 N23S possibly damaging Het
Ggt1 T A 10: 75,576,213 probably benign Het
Gm1966 T A 7: 106,603,883 L51F probably damaging Het
Gm6434 T A 7: 25,882,361 noncoding transcript Het
Gm6614 T G 6: 141,985,477 probably benign Het
Grik4 A T 9: 42,622,096 L376* probably null Het
Gzf1 A G 2: 148,683,833 T75A probably benign Het
Hcn1 T C 13: 117,975,375 I625T unknown Het
Hhat C T 1: 192,552,934 probably null Het
Ifit1bl1 T C 19: 34,594,514 E181G probably damaging Het
Kif21a T C 15: 90,968,054 probably benign Het
Lrrc45 A C 11: 120,715,219 S118R probably damaging Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Ms4a5 A G 19: 11,283,654 L47S probably damaging Het
Mynn A T 3: 30,607,459 N230I probably benign Het
Nck2 T C 1: 43,554,118 S162P probably damaging Het
Nfat5 T C 8: 107,367,461 F259S probably damaging Het
Obox1 T G 7: 15,556,253 S174A possibly damaging Het
Ociad1 T A 5: 73,313,429 probably null Het
Phlpp2 T C 8: 109,939,935 V1032A probably damaging Het
Ppm1e C T 11: 87,240,614 A318T probably damaging Het
Prex1 T A 2: 166,589,571 D757V probably benign Het
Ptpdc1 C A 13: 48,589,119 probably null Het
Rbbp5 T G 1: 132,493,844 I94R possibly damaging Het
Rnpc3 A G 3: 113,621,869 V173A probably benign Het
Sgsm1 A T 5: 113,263,759 N700K probably benign Het
Sox14 T A 9: 99,875,122 H188L probably damaging Het
Supt5 T A 7: 28,317,329 probably benign Het
Synpo A G 18: 60,602,418 S819P probably damaging Het
Tenm2 A G 11: 36,207,124 probably benign Het
Tenm4 T C 7: 96,873,766 V1468A possibly damaging Het
Tiam2 A G 17: 3,502,918 N83S probably benign Het
Tle6 T C 10: 81,595,311 probably benign Het
Tm2d2 T G 8: 25,018,114 N91K probably damaging Het
Tmem132d T G 5: 127,864,646 Q463H probably benign Het
Tmf1 A G 6: 97,176,141 S324P probably damaging Het
Tnc T C 4: 64,000,159 T1172A probably benign Het
Usp17lb A T 7: 104,840,539 C393S probably benign Het
Usp42 G A 5: 143,714,861 L1136F probably damaging Het
Vmn2r92 T G 17: 18,168,921 M499R probably benign Het
Vps54 T A 11: 21,311,071 probably benign Het
Wdr6 C T 9: 108,573,101 R1076H probably benign Het
Wdr72 T A 9: 74,210,757 M917K possibly damaging Het
Wee2 T C 6: 40,456,995 V281A probably benign Het
Zc3h6 A G 2: 129,014,827 D609G probably benign Het
Zfp345 G A 2: 150,473,243 H125Y possibly damaging Het
Zhx2 A G 15: 57,821,840 K202E probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Pgbd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Pgbd1 APN 13 21423253 nonsense probably null
IGL03136:Pgbd1 APN 13 21433439 missense possibly damaging 0.46
R0206:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0208:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R0547:Pgbd1 UTSW 13 21423518 missense probably damaging 1.00
R0589:Pgbd1 UTSW 13 21434430 missense possibly damaging 0.92
R0854:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R0891:Pgbd1 UTSW 13 21422800 missense probably damaging 0.97
R1589:Pgbd1 UTSW 13 21423292 missense probably damaging 0.97
R1700:Pgbd1 UTSW 13 21434481 missense probably damaging 0.99
R1815:Pgbd1 UTSW 13 21423172 missense probably damaging 0.99
R2139:Pgbd1 UTSW 13 21423020 missense probably damaging 1.00
R3776:Pgbd1 UTSW 13 21428373 missense probably benign 0.00
R3870:Pgbd1 UTSW 13 21434370 missense possibly damaging 0.95
R3871:Pgbd1 UTSW 13 21434370 missense possibly damaging 0.95
R4580:Pgbd1 UTSW 13 21428329 missense probably benign 0.07
R5644:Pgbd1 UTSW 13 21423152 missense probably damaging 0.99
R6480:Pgbd1 UTSW 13 21423476 missense probably benign 0.13
R6978:Pgbd1 UTSW 13 21423262 missense probably damaging 1.00
R7084:Pgbd1 UTSW 13 21423130 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- TCCACACCCGAGTCTTCTTGGTAAG -3'
(R):5'- ACAATGAGCCTGAGGTACAGCCTG -3'

Sequencing Primer
(F):5'- ACCAGATAGCCTTGCGTAGTTAG -3'
(R):5'- CATCCCTGAGAAGAGCTGGAC -3'
Posted On2013-05-09