Mutagenetix > Incidental Mutation

Incidental Mutation 'R4820:Mmrn1'

370123

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

MMRRC Submission

042436-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4820 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 60973043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 326 (V326I)

Ref Sequence

ENSEMBL: ENSMUSP00000145156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000129603
AA Change: V326I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: V326I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000204333
AA Change: V326I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: V326I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 92.9%

Validation Efficiency

96% (104/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930488N24Rik	T	C	17: 14,106,219		noncoding transcript	Het
5730455P16Rik	A	T	11: 80,375,520	S132T	possibly damaging	Het
9930021J03Rik	T	C	19: 29,718,409	N1228S	possibly damaging	Het
Aadacl3	T	A	4: 144,457,957	H77L	probably damaging	Het
Actr5	T	A	2: 158,625,506	V122D	probably damaging	Het
Adamts7	A	G	9: 90,189,686	D678G	possibly damaging	Het
Alpk1	T	A	3: 127,671,059	D1190V	probably benign	Het
Apbb1ip	A	T	2: 22,875,253	N649Y	unknown	Het
Atp6v0a1	A	G	11: 101,042,950	I522V	probably benign	Het
Cars	T	C	7: 143,570,564	D375G	probably damaging	Het
Catspere1	A	T	1: 177,859,875		noncoding transcript	Het
Ccdc87	A	G	19: 4,840,551	D357G	probably damaging	Het
Cd101	A	T	3: 101,022,155	S8T	probably benign	Het
Cfap65	C	T	1: 74,927,632	A299T	probably benign	Het
Cic	T	C	7: 25,271,732	V296A	possibly damaging	Het
Col7a1	T	A	9: 108,968,607	S1686T	possibly damaging	Het
Ctbp2	A	C	7: 133,013,694	L504R	probably damaging	Het
Cttnbp2nl	T	C	3: 105,011,324	K67E	probably benign	Het
Cyp2c50	C	T	19: 40,113,580	P480S	probably damaging	Het
Dcdc5	A	C	2: 106,336,075		noncoding transcript	Het
Defb2	G	T	8: 21,843,301	E31*	probably null	Het
Dhrs1	T	A	14: 55,739,626	N244I	possibly damaging	Het
Dopey2	A	G	16: 93,793,090	I134V	probably benign	Het
Etl4	A	G	2: 20,806,685	D1193G	possibly damaging	Het
Ezh1	A	C	11: 101,203,768	S399R	probably damaging	Het
Fam161a	T	C	11: 23,020,076	S26P	probably damaging	Het
Fam205a1	T	A	4: 42,851,815	I114F	probably damaging	Het
Fcgbp	C	A	7: 28,113,958	S2306Y	probably damaging	Het
Fras1	T	C	5: 96,728,653	I2415T	probably benign	Het
Gas2l3	A	G	10: 89,417,045	L246P	probably damaging	Het
Gdf15	C	T	8: 70,629,596	V287M	probably damaging	Het
Gm10354	G	T	5: 14,976,211	T144K	probably benign	Het
Gm2056	A	T	12: 88,027,388	I129F	unknown	Het
Gm7742	T	C	17: 21,199,973		noncoding transcript	Het
Grin2d	T	C	7: 45,857,939	D446G	probably damaging	Het
Hemk1	A	G	9: 107,328,186	F107L	probably benign	Het
Hmgcr	C	T	13: 96,660,192	G197S	probably damaging	Het
Ift52	G	A	2: 163,031,188	G207D	probably benign	Het
Il17re	A	G	6: 113,465,855	T275A	probably benign	Het
Iqcf3	T	C	9: 106,553,589		probably benign	Het
Kcna1	A	G	6: 126,642,136	I407T	probably damaging	Het
Kcnrg	T	A	14: 61,607,937	M142K	probably benign	Het
Lhx9	C	A	1: 138,838,367	V237L	probably benign	Het
Lipo3	A	C	19: 33,583,097	I56S	probably damaging	Het
Loxhd1	C	G	18: 77,384,967	P1060R	probably damaging	Het
Map2k4	A	C	11: 65,696,375		probably benign	Het
Methig1	A	G	15: 100,353,535	K109R	possibly damaging	Het
Myo15	G	A	11: 60,476,915	R167H	probably damaging	Het
Ncoa7	G	A	10: 30,648,476	T142M	probably damaging	Het
Nfkb2	C	A	19: 46,308,054	Q254K	probably damaging	Het
Nol6	G	T	4: 41,121,508	P278Q	probably damaging	Het
Nptxr	T	A	15: 79,792,826	D285V	probably damaging	Het
Olfr1414	A	T	1: 92,511,090	*313K	probably null	Het
Olfr429	A	G	1: 174,089,176	I45M	possibly damaging	Het
Oosp3	T	C	19: 11,711,633	W82R	probably damaging	Het
Pa2g4	G	T	10: 128,559,330	T322K	probably damaging	Het
Parp16	C	A	9: 65,237,893	F291L	probably damaging	Het
Pdzd9	A	T	7: 120,668,396	D65E	probably damaging	Het
Pgap3	A	G	11: 98,390,474	W238R	probably damaging	Het
Pgf	G	A	12: 85,171,764	H67Y	probably benign	Het
Pik3cb	T	C	9: 99,073,626	T413A	probably benign	Het
Plcxd2	A	T	16: 45,980,337	C175S	probably benign	Het
Pou2f1	A	T	1: 165,891,948		probably benign	Het
Ppfia1	T	G	7: 144,498,369	N846T	probably benign	Het
Ppid	T	A	3: 79,595,197		probably null	Het
Prkcq	G	A	2: 11,226,986		probably null	Het
Ptgds	T	C	2: 25,469,046	K66E	probably benign	Het
Ptpmt1	A	G	2: 90,917,938		noncoding transcript	Het
Rab3il1	G	A	19: 10,026,670	G51D	probably benign	Het
Rdx	T	C	9: 52,063,591	V9A	probably damaging	Het
Rpl7l1	T	C	17: 46,778,088	N239S	probably benign	Het
Rrbp1	C	A	2: 143,964,765	A978S	possibly damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGCCGGCGGCG	7: 97,579,919		probably benign	Het
Scn3a	A	T	2: 65,461,278	I1708N	probably damaging	Het
Serinc1	A	G	10: 57,525,370	I109T	possibly damaging	Het
Shroom1	G	A	11: 53,465,139	V339I	probably benign	Het
Slc30a8	T	A	15: 52,306,484	C36S	probably benign	Het
Slc9a3r1	A	G	11: 115,180,092	E290G	probably benign	Het
Slco1b2	A	G	6: 141,685,432	I597M	probably benign	Het
Snx27	A	G	3: 94,520,211	F228S	probably damaging	Het
Stim1	T	A	7: 102,415,364	F214I	probably damaging	Het
Svep1	T	C	4: 58,082,664	T1987A	probably benign	Het
Tamm41	A	G	6: 115,025,417	I18T	possibly damaging	Het
Tmem150b	T	A	7: 4,723,872	D79V	probably damaging	Het
Tmem167	T	A	13: 90,104,429	I68N	probably benign	Het
Traf3	A	G	12: 111,260,770	E339G	possibly damaging	Het
Tspan12	G	A	6: 21,795,661	P177S	probably damaging	Het
Ttn	A	G	2: 76,953,218	I810T	probably benign	Het
Ulk1	T	C	5: 110,792,130	T407A	probably benign	Het
Uroc1	G	A	6: 90,357,618		probably null	Het
Vmn2r-ps69	T	C	7: 85,310,376		noncoding transcript	Het
Wdr59	T	C	8: 111,480,814	N476S	probably benign	Het
Zfp472	A	G	17: 32,977,442	M164V	probably benign	Het
Zfp608	T	C	18: 54,987,684	N277S	probably benign	Het
Zfp831	T	C	2: 174,705,304	C1427R	possibly damaging	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4590:Mmrn1	UTSW	6	60960813	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CATGTTGCCACTCACCTGTAAC -3'
(R):5'- CAAATGACAGGAGACAATGTCACTG -3'

Sequencing Primer
(F):5'- GTTGAATGGTCCCAACTC -3'
(R):5'- AGACAATGTCACTGAGGAATTTG -3'

Posted On

2016-02-04