Mutagenetix > Incidental Mutation

Incidental Mutation 'R4820:Stim1'

370136

Institutional Source

Beutler Lab

Gene Symbol

Stim1

Ensembl Gene

ENSMUSG00000030987

Gene Name

stromal interaction molecule 1

Synonyms

SIM

MMRRC Submission

042436-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4820 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102267806-102437319 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102415364 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 214 (F214I)

Ref Sequence

ENSEMBL: ENSMUSP00000147443 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033289] [ENSMUST00000209255] [ENSMUST00000211457]

AlphaFold

P70302

Predicted Effect

possibly damaging
Transcript: ENSMUST00000033289
AA Change: F214I

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000033289
Gene: ENSMUSG00000030987
AA Change: F214I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	32	47	N/A	INTRINSIC
SAM	129	200	5.51e-6	SMART
SCOP:d1eq1a_	229	334	1e-2	SMART
PDB:4O9B\|D	237	340	3e-59	PDB
Pfam:SOAR	341	441	1.4e-46	PFAM
low complexity region	485	499	N/A	INTRINSIC
low complexity region	601	631	N/A	INTRINSIC
low complexity region	672	685	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000209255
AA Change: F214I

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211457
AA Change: F214I

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)

Meta Mutation Damage Score

0.1251

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 92.9%

Validation Efficiency

96% (104/108)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type 1 transmembrane protein that mediates Ca2+ influx after depletion of intracellular Ca2+ stores by gating of store-operated Ca2+ influx channels (SOCs). It is one of several genes located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocrotical carcinoma, and lung, ovarian, and breast cancer. This gene may play a role in malignancies and disease that involve this region, as well as early hematopoiesis, by mediating attachment to stromal cells. Mutations in this gene are associated with fatal classic Kaposi sarcoma, immunodeficiency due to defects in store-operated calcium entry (SOCE) in fibroblasts, ectodermal dysplasia and tubular aggregate myopathy. This gene is oriented in a head-to-tail configuration with the ribonucleotide reductase 1 gene (RRM1), with the 3' end of this gene situated 1.6 kb from the 5' end of the RRM1 gene. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit perinatal and postnatal lethality, with all mice dying by 2 weeks of age, and severe growth retardation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930488N24Rik	T	C	17: 14,106,219		noncoding transcript	Het
5730455P16Rik	A	T	11: 80,375,520	S132T	possibly damaging	Het
9930021J03Rik	T	C	19: 29,718,409	N1228S	possibly damaging	Het
Aadacl3	T	A	4: 144,457,957	H77L	probably damaging	Het
Actr5	T	A	2: 158,625,506	V122D	probably damaging	Het
Adamts7	A	G	9: 90,189,686	D678G	possibly damaging	Het
Alpk1	T	A	3: 127,671,059	D1190V	probably benign	Het
Apbb1ip	A	T	2: 22,875,253	N649Y	unknown	Het
Atp6v0a1	A	G	11: 101,042,950	I522V	probably benign	Het
Cars	T	C	7: 143,570,564	D375G	probably damaging	Het
Catspere1	A	T	1: 177,859,875		noncoding transcript	Het
Ccdc87	A	G	19: 4,840,551	D357G	probably damaging	Het
Cd101	A	T	3: 101,022,155	S8T	probably benign	Het
Cfap65	C	T	1: 74,927,632	A299T	probably benign	Het
Cic	T	C	7: 25,271,732	V296A	possibly damaging	Het
Col7a1	T	A	9: 108,968,607	S1686T	possibly damaging	Het
Ctbp2	A	C	7: 133,013,694	L504R	probably damaging	Het
Cttnbp2nl	T	C	3: 105,011,324	K67E	probably benign	Het
Cyp2c50	C	T	19: 40,113,580	P480S	probably damaging	Het
Dcdc5	A	C	2: 106,336,075		noncoding transcript	Het
Defb2	G	T	8: 21,843,301	E31*	probably null	Het
Dhrs1	T	A	14: 55,739,626	N244I	possibly damaging	Het
Dopey2	A	G	16: 93,793,090	I134V	probably benign	Het
Etl4	A	G	2: 20,806,685	D1193G	possibly damaging	Het
Ezh1	A	C	11: 101,203,768	S399R	probably damaging	Het
Fam161a	T	C	11: 23,020,076	S26P	probably damaging	Het
Fam205a1	T	A	4: 42,851,815	I114F	probably damaging	Het
Fcgbp	C	A	7: 28,113,958	S2306Y	probably damaging	Het
Fras1	T	C	5: 96,728,653	I2415T	probably benign	Het
Gas2l3	A	G	10: 89,417,045	L246P	probably damaging	Het
Gdf15	C	T	8: 70,629,596	V287M	probably damaging	Het
Gm10354	G	T	5: 14,976,211	T144K	probably benign	Het
Gm2056	A	T	12: 88,027,388	I129F	unknown	Het
Gm7742	T	C	17: 21,199,973		noncoding transcript	Het
Grin2d	T	C	7: 45,857,939	D446G	probably damaging	Het
Hemk1	A	G	9: 107,328,186	F107L	probably benign	Het
Hmgcr	C	T	13: 96,660,192	G197S	probably damaging	Het
Ift52	G	A	2: 163,031,188	G207D	probably benign	Het
Il17re	A	G	6: 113,465,855	T275A	probably benign	Het
Iqcf3	T	C	9: 106,553,589		probably benign	Het
Kcna1	A	G	6: 126,642,136	I407T	probably damaging	Het
Kcnrg	T	A	14: 61,607,937	M142K	probably benign	Het
Lhx9	C	A	1: 138,838,367	V237L	probably benign	Het
Lipo3	A	C	19: 33,583,097	I56S	probably damaging	Het
Loxhd1	C	G	18: 77,384,967	P1060R	probably damaging	Het
Map2k4	A	C	11: 65,696,375		probably benign	Het
Methig1	A	G	15: 100,353,535	K109R	possibly damaging	Het
Mmrn1	G	A	6: 60,973,043	V326I	probably benign	Het
Myo15	G	A	11: 60,476,915	R167H	probably damaging	Het
Ncoa7	G	A	10: 30,648,476	T142M	probably damaging	Het
Nfkb2	C	A	19: 46,308,054	Q254K	probably damaging	Het
Nol6	G	T	4: 41,121,508	P278Q	probably damaging	Het
Nptxr	T	A	15: 79,792,826	D285V	probably damaging	Het
Olfr1414	A	T	1: 92,511,090	*313K	probably null	Het
Olfr429	A	G	1: 174,089,176	I45M	possibly damaging	Het
Oosp3	T	C	19: 11,711,633	W82R	probably damaging	Het
Pa2g4	G	T	10: 128,559,330	T322K	probably damaging	Het
Parp16	C	A	9: 65,237,893	F291L	probably damaging	Het
Pdzd9	A	T	7: 120,668,396	D65E	probably damaging	Het
Pgap3	A	G	11: 98,390,474	W238R	probably damaging	Het
Pgf	G	A	12: 85,171,764	H67Y	probably benign	Het
Pik3cb	T	C	9: 99,073,626	T413A	probably benign	Het
Plcxd2	A	T	16: 45,980,337	C175S	probably benign	Het
Pou2f1	A	T	1: 165,891,948		probably benign	Het
Ppfia1	T	G	7: 144,498,369	N846T	probably benign	Het
Ppid	T	A	3: 79,595,197		probably null	Het
Prkcq	G	A	2: 11,226,986		probably null	Het
Ptgds	T	C	2: 25,469,046	K66E	probably benign	Het
Ptpmt1	A	G	2: 90,917,938		noncoding transcript	Het
Rab3il1	G	A	19: 10,026,670	G51D	probably benign	Het
Rdx	T	C	9: 52,063,591	V9A	probably damaging	Het
Rpl7l1	T	C	17: 46,778,088	N239S	probably benign	Het
Rrbp1	C	A	2: 143,964,765	A978S	possibly damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGCCGGCGGCG	7: 97,579,919		probably benign	Het
Scn3a	A	T	2: 65,461,278	I1708N	probably damaging	Het
Serinc1	A	G	10: 57,525,370	I109T	possibly damaging	Het
Shroom1	G	A	11: 53,465,139	V339I	probably benign	Het
Slc30a8	T	A	15: 52,306,484	C36S	probably benign	Het
Slc9a3r1	A	G	11: 115,180,092	E290G	probably benign	Het
Slco1b2	A	G	6: 141,685,432	I597M	probably benign	Het
Snx27	A	G	3: 94,520,211	F228S	probably damaging	Het
Svep1	T	C	4: 58,082,664	T1987A	probably benign	Het
Tamm41	A	G	6: 115,025,417	I18T	possibly damaging	Het
Tmem150b	T	A	7: 4,723,872	D79V	probably damaging	Het
Tmem167	T	A	13: 90,104,429	I68N	probably benign	Het
Traf3	A	G	12: 111,260,770	E339G	possibly damaging	Het
Tspan12	G	A	6: 21,795,661	P177S	probably damaging	Het
Ttn	A	G	2: 76,953,218	I810T	probably benign	Het
Ulk1	T	C	5: 110,792,130	T407A	probably benign	Het
Uroc1	G	A	6: 90,357,618		probably null	Het
Vmn2r-ps69	T	C	7: 85,310,376		noncoding transcript	Het
Wdr59	T	C	8: 111,480,814	N476S	probably benign	Het
Zfp472	A	G	17: 32,977,442	M164V	probably benign	Het
Zfp608	T	C	18: 54,987,684	N277S	probably benign	Het
Zfp831	T	C	2: 174,705,304	C1427R	possibly damaging	Het

Other mutations in Stim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00990:Stim1	APN	7	102426747	missense	probably damaging	1.00
IGL01390:Stim1	APN	7	102427162	missense	possibly damaging	0.73
IGL01602:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01605:Stim1	APN	7	102386115	missense	possibly damaging	0.86
IGL01697:Stim1	APN	7	102425969	splice site	probably benign
IGL01826:Stim1	APN	7	102427075	splice site	probably benign
IGL01908:Stim1	APN	7	102435650	missense	probably benign
IGL02869:Stim1	APN	7	102268551	missense	unknown
IGL03146:Stim1	APN	7	102421355	missense	probably damaging	1.00
R0217:Stim1	UTSW	7	102435800	missense	probably benign	0.00
R1320:Stim1	UTSW	7	102408406	missense	possibly damaging	0.79
R1639:Stim1	UTSW	7	102354541	missense	probably benign	0.31
R1643:Stim1	UTSW	7	102386100	missense	possibly damaging	0.92
R1697:Stim1	UTSW	7	102354506	missense	probably damaging	1.00
R2424:Stim1	UTSW	7	102408405	missense	probably benign	0.03
R3838:Stim1	UTSW	7	102411296	missense	possibly damaging	0.71
R3940:Stim1	UTSW	7	102435641	missense	probably benign	0.00
R4871:Stim1	UTSW	7	102354572	missense	probably damaging	1.00
R5110:Stim1	UTSW	7	102268422	missense	unknown
R5787:Stim1	UTSW	7	102435440	missense	possibly damaging	0.52
R6400:Stim1	UTSW	7	102430950	missense	probably null	0.99
R6788:Stim1	UTSW	7	102427291	missense	probably damaging	0.99
R7112:Stim1	UTSW	7	102408408	missense	probably benign	0.01
R7125:Stim1	UTSW	7	102435534	missense	possibly damaging	0.69
R7247:Stim1	UTSW	7	102421532	critical splice donor site	probably null
R7650:Stim1	UTSW	7	102428827	missense
R7807:Stim1	UTSW	7	102427141	missense	probably damaging	0.99
R8304:Stim1	UTSW	7	102435481	missense	possibly damaging	0.55
R8462:Stim1	UTSW	7	102427117	missense	probably damaging	1.00
R8528:Stim1	UTSW	7	102431082	intron	probably benign
R8883:Stim1	UTSW	7	102431050	missense	unknown
R8921:Stim1	UTSW	7	102421390	missense	probably damaging	0.99
R8924:Stim1	UTSW	7	102428807	missense
R9018:Stim1	UTSW	7	102411275	missense	probably benign	0.05
R9164:Stim1	UTSW	7	102435419	missense	probably benign	0.35
R9396:Stim1	UTSW	7	102415385	missense	possibly damaging	0.63
R9487:Stim1	UTSW	7	102431050	missense	unknown
R9501:Stim1	UTSW	7	102411299	missense	possibly damaging	0.92
R9697:Stim1	UTSW	7	102428807	missense
R9710:Stim1	UTSW	7	102430911	small deletion	probably benign
R9734:Stim1	UTSW	7	102415353	missense	possibly damaging	0.56

Predicted Primers

PCR Primer
(F):5'- TCCAAAGGAGGACTTGGCAG -3'
(R):5'- ACAGGAGACTTCTAAGAGCTGG -3'

Sequencing Primer
(F):5'- GAGAGATAGGCACAGACTTTATTATG -3'
(R):5'- CCTGATCTACAAAGTGAGTTCCAGG -3'

Posted On

2016-02-04