Incidental Mutation 'R0420:Kif21a'
ID37019
Institutional Source Beutler Lab
Gene Symbol Kif21a
Ensembl Gene ENSMUSG00000022629
Gene Namekinesin family member 21A
SynonymsN-5 kinesin
MMRRC Submission 038622-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0420 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location90933276-91049948 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 90968054 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155710 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067205] [ENSMUST00000088614] [ENSMUST00000100304] [ENSMUST00000109287] [ENSMUST00000109288] [ENSMUST00000229801]
Predicted Effect probably benign
Transcript: ENSMUST00000067205
SMART Domains Protein: ENSMUSP00000066911
Gene: ENSMUSG00000022629

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1251 1271 N/A INTRINSIC
WD40 1290 1327 1.21e-7 SMART
WD40 1330 1368 7.28e-2 SMART
WD40 1394 1432 3.33e-1 SMART
WD40 1435 1477 7e-4 SMART
WD40 1485 1523 2.4e-1 SMART
WD40 1527 1566 1.48e-2 SMART
WD40 1569 1606 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000088614
SMART Domains Protein: ENSMUSP00000085985
Gene: ENSMUSG00000022629

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100304
SMART Domains Protein: ENSMUSP00000097877
Gene: ENSMUSG00000022629

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 1e-8 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 564 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
low complexity region 602 641 N/A INTRINSIC
low complexity region 713 726 N/A INTRINSIC
coiled coil region 937 1021 N/A INTRINSIC
coiled coil region 1056 1079 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
low complexity region 1300 1316 N/A INTRINSIC
WD40 1334 1371 1.21e-7 SMART
WD40 1374 1412 7.28e-2 SMART
WD40 1438 1476 3.33e-1 SMART
WD40 1479 1521 7e-4 SMART
WD40 1529 1567 2.4e-1 SMART
WD40 1571 1610 1.48e-2 SMART
WD40 1613 1650 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109287
SMART Domains Protein: ENSMUSP00000104910
Gene: ENSMUSG00000022629

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
WD40 1229 1266 1.21e-7 SMART
WD40 1269 1307 7.28e-2 SMART
WD40 1333 1371 3.33e-1 SMART
WD40 1374 1416 7e-4 SMART
WD40 1424 1462 2.4e-1 SMART
WD40 1466 1505 1.48e-2 SMART
WD40 1508 1545 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109288
SMART Domains Protein: ENSMUSP00000104911
Gene: ENSMUSG00000022629

DomainStartEndE-ValueType
KISc 7 379 8.97e-163 SMART
Blast:KISc 469 513 9e-9 BLAST
low complexity region 514 525 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 571 585 N/A INTRINSIC
low complexity region 589 628 N/A INTRINSIC
low complexity region 700 713 N/A INTRINSIC
coiled coil region 924 1008 N/A INTRINSIC
coiled coil region 1043 1066 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
WD40 1235 1272 1.21e-7 SMART
WD40 1275 1313 7.28e-2 SMART
WD40 1339 1377 3.33e-1 SMART
WD40 1380 1422 7e-4 SMART
WD40 1430 1468 2.4e-1 SMART
WD40 1472 1511 1.48e-2 SMART
WD40 1514 1551 2.07e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000229801
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the KIF4 subfamily of kinesin-like motor proteins. The encoded protein is characterized by an N-terminal motor domain a coiled-coil stalk domain and a C-terminal WD-40 repeat domain. This protein may be involved in microtubule dependent transport. Mutations in this gene are the cause of congenital fibrosis of extraocular muscles-1. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,571,094 S17G probably benign Het
Abcb4 T C 5: 8,941,050 V870A probably benign Het
Adam6b A T 12: 113,489,994 M144L probably benign Het
Adrb2 T A 18: 62,179,539 I72L possibly damaging Het
Ankrd53 A T 6: 83,763,692 H99L probably damaging Het
Ap4e1 C T 2: 127,049,360 T17M probably damaging Het
Arnt T A 3: 95,470,394 probably benign Het
Atp1a3 C T 7: 24,980,627 G884E probably benign Het
Atp6v1b1 T C 6: 83,752,844 probably benign Het
Atp8a2 G T 14: 59,773,744 T971K probably damaging Het
BC048562 A T 9: 108,445,966 T167S probably benign Het
Brd9 A G 13: 73,955,473 M491V probably benign Het
Btnl10 A T 11: 58,923,451 D319V probably damaging Het
Cadps T A 14: 12,491,800 R783S probably damaging Het
Ccdc149 A G 5: 52,400,239 probably benign Het
Ccm2l A T 2: 153,070,862 D107V probably null Het
Cep192 A G 18: 67,813,893 E213G possibly damaging Het
Cyp2c37 A C 19: 39,995,794 N242T probably benign Het
Dnah17 A G 11: 118,039,939 V3750A probably damaging Het
Ehbp1 T A 11: 22,151,836 I231L probably benign Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eya4 T C 10: 23,155,963 N254S possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Fancd2 T C 6: 113,536,979 L108P probably damaging Het
Fgf12 A T 16: 28,162,529 M145K possibly damaging Het
Gabbr1 A G 17: 37,046,762 N23S possibly damaging Het
Ggt1 T A 10: 75,576,213 probably benign Het
Gm1966 T A 7: 106,603,883 L51F probably damaging Het
Gm6434 T A 7: 25,882,361 noncoding transcript Het
Gm6614 T G 6: 141,985,477 probably benign Het
Grik4 A T 9: 42,622,096 L376* probably null Het
Gzf1 A G 2: 148,683,833 T75A probably benign Het
Hcn1 T C 13: 117,975,375 I625T unknown Het
Hhat C T 1: 192,552,934 probably null Het
Ifit1bl1 T C 19: 34,594,514 E181G probably damaging Het
Lrrc45 A C 11: 120,715,219 S118R probably damaging Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Ms4a5 A G 19: 11,283,654 L47S probably damaging Het
Mynn A T 3: 30,607,459 N230I probably benign Het
Nck2 T C 1: 43,554,118 S162P probably damaging Het
Nfat5 T C 8: 107,367,461 F259S probably damaging Het
Obox1 T G 7: 15,556,253 S174A possibly damaging Het
Ociad1 T A 5: 73,313,429 probably null Het
Pgbd1 A T 13: 21,423,166 V286E possibly damaging Het
Phlpp2 T C 8: 109,939,935 V1032A probably damaging Het
Ppm1e C T 11: 87,240,614 A318T probably damaging Het
Prex1 T A 2: 166,589,571 D757V probably benign Het
Ptpdc1 C A 13: 48,589,119 probably null Het
Rbbp5 T G 1: 132,493,844 I94R possibly damaging Het
Rnpc3 A G 3: 113,621,869 V173A probably benign Het
Sgsm1 A T 5: 113,263,759 N700K probably benign Het
Sox14 T A 9: 99,875,122 H188L probably damaging Het
Supt5 T A 7: 28,317,329 probably benign Het
Synpo A G 18: 60,602,418 S819P probably damaging Het
Tenm2 A G 11: 36,207,124 probably benign Het
Tenm4 T C 7: 96,873,766 V1468A possibly damaging Het
Tiam2 A G 17: 3,502,918 N83S probably benign Het
Tle6 T C 10: 81,595,311 probably benign Het
Tm2d2 T G 8: 25,018,114 N91K probably damaging Het
Tmem132d T G 5: 127,864,646 Q463H probably benign Het
Tmf1 A G 6: 97,176,141 S324P probably damaging Het
Tnc T C 4: 64,000,159 T1172A probably benign Het
Usp17lb A T 7: 104,840,539 C393S probably benign Het
Usp42 G A 5: 143,714,861 L1136F probably damaging Het
Vmn2r92 T G 17: 18,168,921 M499R probably benign Het
Vps54 T A 11: 21,311,071 probably benign Het
Wdr6 C T 9: 108,573,101 R1076H probably benign Het
Wdr72 T A 9: 74,210,757 M917K possibly damaging Het
Wee2 T C 6: 40,456,995 V281A probably benign Het
Zc3h6 A G 2: 129,014,827 D609G probably benign Het
Zfp345 G A 2: 150,473,243 H125Y possibly damaging Het
Zhx2 A G 15: 57,821,840 K202E probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Kif21a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Kif21a APN 15 90937301 missense probably damaging 1.00
IGL01476:Kif21a APN 15 90943864 missense possibly damaging 0.66
IGL01617:Kif21a APN 15 90995637 splice site probably benign
IGL01736:Kif21a APN 15 90959745 missense possibly damaging 0.59
IGL01923:Kif21a APN 15 90956430 missense probably damaging 0.96
IGL01985:Kif21a APN 15 90991767 missense probably damaging 1.00
IGL02304:Kif21a APN 15 90965535 missense probably damaging 1.00
IGL02589:Kif21a APN 15 90985286 missense probably damaging 1.00
IGL03115:Kif21a APN 15 90985395 missense probably damaging 0.99
IGL03211:Kif21a APN 15 90997963 missense possibly damaging 0.73
IGL03372:Kif21a APN 15 90956376 missense probably benign 0.38
reflex UTSW 15 90968358 missense probably null 1.00
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0052:Kif21a UTSW 15 90970857 missense probably damaging 0.98
R0304:Kif21a UTSW 15 90976521 splice site probably null
R0378:Kif21a UTSW 15 90969774 splice site probably null
R0536:Kif21a UTSW 15 90959683 splice site probably benign
R0826:Kif21a UTSW 15 90997541 critical splice donor site probably null
R0971:Kif21a UTSW 15 90940581 missense possibly damaging 0.46
R1052:Kif21a UTSW 15 90935650 missense probably benign 0.17
R1168:Kif21a UTSW 15 90993753 missense probably damaging 1.00
R1324:Kif21a UTSW 15 90948322 critical splice donor site probably null
R1471:Kif21a UTSW 15 90956419 missense probably benign 0.04
R1625:Kif21a UTSW 15 90942175 missense probably damaging 1.00
R1636:Kif21a UTSW 15 90984805 splice site probably benign
R1647:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1648:Kif21a UTSW 15 90994367 missense probably damaging 1.00
R1699:Kif21a UTSW 15 90959743 missense probably damaging 0.99
R1703:Kif21a UTSW 15 90949047 intron probably null
R1795:Kif21a UTSW 15 90972727 splice site probably null
R1812:Kif21a UTSW 15 90971766 missense possibly damaging 0.63
R1959:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1960:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1961:Kif21a UTSW 15 90970848 missense probably damaging 0.99
R1996:Kif21a UTSW 15 90994371 nonsense probably null
R2230:Kif21a UTSW 15 90985362 nonsense probably null
R2231:Kif21a UTSW 15 90985362 nonsense probably null
R2232:Kif21a UTSW 15 90985362 nonsense probably null
R2424:Kif21a UTSW 15 90971196 missense probably damaging 1.00
R2429:Kif21a UTSW 15 90998005 missense probably damaging 1.00
R2513:Kif21a UTSW 15 90994391 missense possibly damaging 0.96
R2846:Kif21a UTSW 15 90934464 missense probably benign
R3027:Kif21a UTSW 15 90972642 missense probably damaging 0.99
R3624:Kif21a UTSW 15 90965595 missense probably damaging 0.99
R3820:Kif21a UTSW 15 90968074 missense probably benign 0.17
R3923:Kif21a UTSW 15 90937294 missense possibly damaging 0.46
R3962:Kif21a UTSW 15 90985409 missense probably damaging 1.00
R4355:Kif21a UTSW 15 90970833 missense probably benign 0.17
R4516:Kif21a UTSW 15 90971142 missense probably benign 0.38
R4530:Kif21a UTSW 15 90968089 unclassified probably null
R4612:Kif21a UTSW 15 90968223 unclassified probably null
R4674:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4675:Kif21a UTSW 15 90940545 missense possibly damaging 0.66
R4698:Kif21a UTSW 15 90956305 missense possibly damaging 0.85
R4712:Kif21a UTSW 15 90984755 missense probably damaging 1.00
R4955:Kif21a UTSW 15 90937190 missense probably damaging 1.00
R4974:Kif21a UTSW 15 90949010 missense probably benign 0.16
R5034:Kif21a UTSW 15 90968358 missense probably null 1.00
R5165:Kif21a UTSW 15 90956376 missense probably benign 0.38
R5464:Kif21a UTSW 15 90993855 missense probably damaging 1.00
R5541:Kif21a UTSW 15 90968113 missense probably damaging 0.99
R5757:Kif21a UTSW 15 90951345 missense probably damaging 1.00
R5936:Kif21a UTSW 15 90935647 missense possibly damaging 0.95
R5976:Kif21a UTSW 15 90935812 missense probably damaging 1.00
R6074:Kif21a UTSW 15 90980892 missense probably benign
R6638:Kif21a UTSW 15 90966407 missense probably damaging 1.00
R6723:Kif21a UTSW 15 90940446 missense probably damaging 0.97
R6785:Kif21a UTSW 15 90935730 missense probably damaging 1.00
R6977:Kif21a UTSW 15 90980837 missense probably damaging 1.00
R7058:Kif21a UTSW 15 90948903 intron probably null
R7147:Kif21a UTSW 15 90980883 missense probably benign 0.13
R7290:Kif21a UTSW 15 90967229 nonsense probably null
R7438:Kif21a UTSW 15 90993796 missense probably benign 0.37
R7593:Kif21a UTSW 15 90943861 missense probably benign 0.03
R7661:Kif21a UTSW 15 90980919 missense possibly damaging 0.89
R7891:Kif21a UTSW 15 90956314 missense probably damaging 1.00
R7974:Kif21a UTSW 15 90956314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTCCAAGAAACAACTGTGGGGCA -3'
(R):5'- ACAGATGACATTATTGGGTGTGTGCAA -3'

Sequencing Primer
(F):5'- actccctaacaaatctacacctc -3'
(R):5'- CATTATTGGGTGTGTGCAATCAAAG -3'
Posted On2013-05-09