Incidental Mutation 'R4821:Lcn6'
ID370196
Institutional Source Beutler Lab
Gene Symbol Lcn6
Ensembl Gene ENSMUSG00000045684
Gene Namelipocalin 6
Synonyms
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4821 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25676786-25681608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 25680810 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 137 (L137M)
Ref Sequence ENSEMBL: ENSMUSP00000109837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058912] [ENSMUST00000059693] [ENSMUST00000114197] [ENSMUST00000114199]
Predicted Effect probably benign
Transcript: ENSMUST00000058912
SMART Domains Protein: ENSMUSP00000059353
Gene: ENSMUSG00000047356

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Lipocalin 36 169 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000059693
AA Change: L71M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055660
Gene: ENSMUSG00000045684
AA Change: L71M

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 1.4e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114197
AA Change: L71M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109835
Gene: ENSMUSG00000045684
AA Change: L71M

DomainStartEndE-ValueType
Pfam:Lipocalin 7 106 4.8e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114199
AA Change: L137M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109837
Gene: ENSMUSG00000045684
AA Change: L137M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Lipocalin 33 172 2.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139441
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice with loss of expression in the testes show premature acrosome reaction and elevated intracellular calcium levels in sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Lcn6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Lcn6 APN 2 25680780 missense probably benign 0.29
R0747:Lcn6 UTSW 2 25677172 missense probably damaging 1.00
R1387:Lcn6 UTSW 2 25677137 missense possibly damaging 0.86
R1500:Lcn6 UTSW 2 25677119 missense probably benign 0.00
R1654:Lcn6 UTSW 2 25680775 unclassified probably null
R3005:Lcn6 UTSW 2 25677249 intron probably null
R4972:Lcn6 UTSW 2 25680067 missense probably damaging 1.00
R5011:Lcn6 UTSW 2 25677070 splice site probably null
R5013:Lcn6 UTSW 2 25677070 splice site probably null
R7779:Lcn6 UTSW 2 25680793 missense probably benign
R8034:Lcn6 UTSW 2 25676871 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGCCAACCCCAGTTTTAC -3'
(R):5'- CTGAGCCTGCTGTTGAGACAAG -3'

Sequencing Primer
(F):5'- TACACCTGGTTGGCACGATG -3'
(R):5'- CCTGCTGTTGAGACAAGAAGCC -3'
Posted On2016-02-04