Mutagenetix > Incidental Mutations

Incidental Mutation 'R4821:Adamtsl2'

370197

Institutional Source

Beutler Lab

Gene Symbol

Adamtsl2

Ensembl Gene

ENSMUSG00000036040

Gene Name

ADAMTS-like 2

Synonyms

A930008K15Rik

MMRRC Submission

042437-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4821 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27079379-27108981 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 27098592 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000088774 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091233]

Predicted Effect

probably null
Transcript: ENSMUST00000091233

SMART Domains

Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TSP1	50	106	5.14e-7	SMART
Pfam:ADAM_spacer1	214	331	5.4e-28	PFAM
low complexity region	345	358	N/A	INTRINSIC
TSP1	573	629	8.15e-1	SMART
TSP1	631	692	1.85e-2	SMART
TSP1	694	744	4.15e-1	SMART
TSP1	747	796	9.98e-5	SMART
TSP1	803	861	4.95e-2	SMART
TSP1	863	914	2.53e-6	SMART
Pfam:PLAC	922	953	1.4e-12	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143246

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000169787

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	T	C	4: 103,235,674	K150R	probably damaging	Het
4930430A15Rik	T	C	2: 111,204,145		probably null	Het
Aak1	T	C	6: 86,850,189	V46A	probably damaging	Het
Abcb9	T	C	5: 124,090,149	T10A	probably benign	Het
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam33	G	A	2: 131,061,195	P43L	probably benign	Het
Akap13	A	G	7: 75,677,507		probably benign	Het
Art1	T	A	7: 102,107,178	L192Q	probably damaging	Het
Baalc	A	G	15: 38,933,180		probably benign	Het
Baz2a	A	G	10: 128,111,109	E164G	probably damaging	Het
Bcs1l	A	G	1: 74,591,985	I391V	probably benign	Het
Cacna1c	T	C	6: 118,696,425	T497A	probably damaging	Het
Cap2	C	A	13: 46,610,110	T164N	probably damaging	Het
Ccdc173	T	C	2: 69,782,108	E96G	possibly damaging	Het
Ccdc57	A	G	11: 120,860,399		probably null	Het
Ccdc88c	T	C	12: 100,938,079	N1120S	probably benign	Het
Chd7	T	A	4: 8,844,706	V1605D	probably damaging	Het
Col12a1	A	T	9: 79,715,340		probably benign	Het
Commd3	T	C	2: 18,672,528	S22P	probably benign	Het
Cpd	T	C	11: 76,846,237	I244V	probably benign	Het
Cpeb2	C	A	5: 43,233,474		probably benign	Het
Cyp2c65	A	G	19: 39,072,191	D165G	probably damaging	Het
Ddx1	T	C	12: 13,239,147	Y152C	probably damaging	Het
Dennd4a	G	A	9: 64,897,249	C1290Y	possibly damaging	Het
Ebf4	G	A	2: 130,307,045	M232I	probably benign	Het
Farp2	A	G	1: 93,574,470		probably null	Het
Frk	T	C	10: 34,484,237	V78A	probably benign	Het
Gm5799	A	G	14: 43,544,641	D90G	probably damaging	Het
Gpr45	C	G	1: 43,030,453		probably benign	Het
Hfm1	C	T	5: 106,854,740		probably null	Het
Igkv4-57-1	T	A	6: 69,544,403	D105V	probably damaging	Het
Impdh2-ps	A	G	8: 100,031,363		noncoding transcript	Het
Kctd4	G	A	14: 75,962,777	V63I	probably benign	Het
Lcn6	T	A	2: 25,680,810	L137M	probably damaging	Het
Lonrf1	T	C	8: 36,219,972	N737D	probably benign	Het
Mcu	C	T	10: 59,467,689	V109M	probably damaging	Het
Mecom	C	A	3: 29,985,351	K186N	probably damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mybpc1	T	C	10: 88,548,865	D533G	probably damaging	Het
Nae1	A	C	8: 104,519,784	C294G	probably damaging	Het
Ncapg2	T	G	12: 116,415,457	H190Q	probably damaging	Het
Nkx2-2	A	T	2: 147,185,843	L59Q	possibly damaging	Het
Nrxn3	C	T	12: 90,204,709	T295I	probably damaging	Het
Obscn	A	T	11: 59,040,467	M5781K	probably damaging	Het
Obscn	C	T	11: 59,006,826		probably benign	Het
Olfr1285	T	C	2: 111,409,225		noncoding transcript	Het
Olfr1427	T	A	19: 12,098,746	M298L	probably benign	Het
Olfr739	A	G	14: 50,424,749	T77A	possibly damaging	Het
Pcdhb6	C	A	18: 37,334,328	P101T	probably damaging	Het
Pot1b	A	G	17: 55,672,885	S324P	possibly damaging	Het
Ppcdc	C	T	9: 57,434,911	V43I	probably benign	Het
Prr13	A	T	15: 102,460,685		probably benign	Het
Rab10os	T	A	12: 3,237,322		noncoding transcript	Het
Rabgap1	T	C	2: 37,532,519	S595P	probably damaging	Het
Rap1gap	T	C	4: 137,712,129	S126P	probably damaging	Het
Rgs6	A	T	12: 83,067,411		probably null	Het
Slc5a6	T	A	5: 31,036,884	K610*	probably null	Het
Sun5	C	T	2: 153,869,466	V27I	probably benign	Het
Tmco5b	T	C	2: 113,289,757	I126T	probably benign	Het
Tmed7	G	A	18: 46,593,413	Q92*	probably null	Het
Trav7d-2	A	G	14: 52,684,428	D98G	probably benign	Het
Trbv16	T	A	6: 41,152,002	L40Q	probably damaging	Het
Ush2a	T	C	1: 188,753,651	V2986A	probably benign	Het
Usp33	T	C	3: 152,358,673	V58A	probably benign	Het
Vmn2r94	T	A	17: 18,257,031	M373L	probably benign	Het
Ywhaq	T	C	12: 21,417,511		probably benign	Het
Zbbx	G	A	3: 75,081,747	H345Y	possibly damaging	Het
Zfp346	G	T	13: 55,113,813		probably benign	Het
Zfp616	C	T	11: 74,084,207	A434V	probably benign	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Adamtsl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00423:Adamtsl2	APN	2	27085088	missense	probably damaging	1.00
IGL01902:Adamtsl2	APN	2	27087252	missense	probably damaging	1.00
IGL02207:Adamtsl2	APN	2	27102981	missense	probably damaging	0.99
IGL02247:Adamtsl2	APN	2	27084893	missense	probably damaging	1.00
IGL02253:Adamtsl2	APN	2	27098697	missense	possibly damaging	0.48
IGL02655:Adamtsl2	APN	2	27082530	splice site	probably benign
IGL03148:Adamtsl2	APN	2	27084059	missense	probably damaging	0.99
IGL03269:Adamtsl2	APN	2	27108355	nonsense	probably null
R0609:Adamtsl2	UTSW	2	27089635	missense	probably benign	0.25
R1183:Adamtsl2	UTSW	2	27084080	missense	probably damaging	1.00
R1443:Adamtsl2	UTSW	2	27103066	missense	possibly damaging	0.89
R1675:Adamtsl2	UTSW	2	27082485	frame shift	probably null
R1698:Adamtsl2	UTSW	2	27103127	missense	possibly damaging	0.92
R1765:Adamtsl2	UTSW	2	27102830	missense	probably benign	0.01
R1934:Adamtsl2	UTSW	2	27089593	missense	probably damaging	0.99
R2106:Adamtsl2	UTSW	2	27102825	missense	probably benign	0.02
R2108:Adamtsl2	UTSW	2	27095558	missense	probably benign
R2189:Adamtsl2	UTSW	2	27081738	missense	probably benign	0.00
R2232:Adamtsl2	UTSW	2	27103178	missense	probably damaging	1.00
R4301:Adamtsl2	UTSW	2	27087283	missense	probably null	1.00
R4518:Adamtsl2	UTSW	2	27095547	missense	probably benign	0.00
R4572:Adamtsl2	UTSW	2	27083256	missense	probably damaging	0.99
R4627:Adamtsl2	UTSW	2	27093585	missense	probably damaging	0.99
R4668:Adamtsl2	UTSW	2	27095475	missense	probably benign	0.00
R4686:Adamtsl2	UTSW	2	27093825	missense	probably damaging	0.99
R5054:Adamtsl2	UTSW	2	27101720	missense	probably damaging	1.00
R5460:Adamtsl2	UTSW	2	27095398	splice site	probably null
R5569:Adamtsl2	UTSW	2	27102833	missense	probably damaging	1.00
R5694:Adamtsl2	UTSW	2	27081724	missense	probably benign	0.03
R6836:Adamtsl2	UTSW	2	27081706	start codon destroyed	probably null	0.90
R7103:Adamtsl2	UTSW	2	27107461	missense	probably damaging	1.00
R7437:Adamtsl2	UTSW	2	27089709	missense	probably damaging	0.99
R8089:Adamtsl2	UTSW	2	27104797	missense	probably benign	0.00
R8389:Adamtsl2	UTSW	2	27103124	missense	possibly damaging	0.71
X0003:Adamtsl2	UTSW	2	27081772	small deletion	probably benign
X0003:Adamtsl2	UTSW	2	27081773	small deletion	probably benign
Z1176:Adamtsl2	UTSW	2	27081720	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGCGTTCCTCTGAAAGAACAG -3'
(R):5'- CCGATCACCATAAAGGCAGG -3'

Sequencing Primer
(F):5'- GTGCCTCAATGCAGAGTCTCTAG -3'
(R):5'- GATCACCATAAAGGCAGGCTCAG -3'

Posted On

2016-02-04