Mutagenetix > Incidental Mutations

Incidental Mutation 'R4821:Olfr1285'

370201

Institutional Source

Beutler Lab

Gene Symbol

Olfr1285

Ensembl Gene

ENSMUSG00000062280

Gene Name

olfactory receptor 1285

Synonyms

MOR248-17P, MOR248-25_p, GA_x6K02T2Q125-72459956-72460837

MMRRC Submission

042437-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R4821 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

111408376-111409331 bp(+) (GRCm38)

Type of Mutation

exon

DNA Base Change (assembly)

T to C at 111409225 bp

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000184954]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184954
AA Change: S284P

SMART Domains

Protein: ENSMUSP00000144852
Gene: ENSMUSG00000096703
AA Change: S284P

Domain	Start	End	E-Value	Type
Pfam:7tm_4	1	264	7.6e-38	PFAM
Pfam:7tm_1	5	251	7.2e-15	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208523

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220153

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	T	C	4: 103,235,674	K150R	probably damaging	Het
4930430A15Rik	T	C	2: 111,204,145		probably null	Het
Aak1	T	C	6: 86,850,189	V46A	probably damaging	Het
Abcb9	T	C	5: 124,090,149	T10A	probably benign	Het
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam33	G	A	2: 131,061,195	P43L	probably benign	Het
Adamtsl2	T	A	2: 27,098,592		probably null	Het
Akap13	A	G	7: 75,677,507		probably benign	Het
Art1	T	A	7: 102,107,178	L192Q	probably damaging	Het
Baalc	A	G	15: 38,933,180		probably benign	Het
Baz2a	A	G	10: 128,111,109	E164G	probably damaging	Het
Bcs1l	A	G	1: 74,591,985	I391V	probably benign	Het
Cacna1c	T	C	6: 118,696,425	T497A	probably damaging	Het
Cap2	C	A	13: 46,610,110	T164N	probably damaging	Het
Ccdc173	T	C	2: 69,782,108	E96G	possibly damaging	Het
Ccdc57	A	G	11: 120,860,399		probably null	Het
Ccdc88c	T	C	12: 100,938,079	N1120S	probably benign	Het
Chd7	T	A	4: 8,844,706	V1605D	probably damaging	Het
Col12a1	A	T	9: 79,715,340		probably benign	Het
Commd3	T	C	2: 18,672,528	S22P	probably benign	Het
Cpd	T	C	11: 76,846,237	I244V	probably benign	Het
Cpeb2	C	A	5: 43,233,474		probably benign	Het
Cyp2c65	A	G	19: 39,072,191	D165G	probably damaging	Het
Ddx1	T	C	12: 13,239,147	Y152C	probably damaging	Het
Dennd4a	G	A	9: 64,897,249	C1290Y	possibly damaging	Het
Ebf4	G	A	2: 130,307,045	M232I	probably benign	Het
Farp2	A	G	1: 93,574,470		probably null	Het
Frk	T	C	10: 34,484,237	V78A	probably benign	Het
Gm5799	A	G	14: 43,544,641	D90G	probably damaging	Het
Gpr45	C	G	1: 43,030,453		probably benign	Het
Hfm1	C	T	5: 106,854,740		probably null	Het
Igkv4-57-1	T	A	6: 69,544,403	D105V	probably damaging	Het
Impdh2-ps	A	G	8: 100,031,363		noncoding transcript	Het
Kctd4	G	A	14: 75,962,777	V63I	probably benign	Het
Lcn6	T	A	2: 25,680,810	L137M	probably damaging	Het
Lonrf1	T	C	8: 36,219,972	N737D	probably benign	Het
Mcu	C	T	10: 59,467,689	V109M	probably damaging	Het
Mecom	C	A	3: 29,985,351	K186N	probably damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mybpc1	T	C	10: 88,548,865	D533G	probably damaging	Het
Nae1	A	C	8: 104,519,784	C294G	probably damaging	Het
Ncapg2	T	G	12: 116,415,457	H190Q	probably damaging	Het
Nkx2-2	A	T	2: 147,185,843	L59Q	possibly damaging	Het
Nrxn3	C	T	12: 90,204,709	T295I	probably damaging	Het
Obscn	C	T	11: 59,006,826		probably benign	Het
Obscn	A	T	11: 59,040,467	M5781K	probably damaging	Het
Olfr1427	T	A	19: 12,098,746	M298L	probably benign	Het
Olfr739	A	G	14: 50,424,749	T77A	possibly damaging	Het
Pcdhb6	C	A	18: 37,334,328	P101T	probably damaging	Het
Pot1b	A	G	17: 55,672,885	S324P	possibly damaging	Het
Ppcdc	C	T	9: 57,434,911	V43I	probably benign	Het
Prr13	A	T	15: 102,460,685		probably benign	Het
Rab10os	T	A	12: 3,237,322		noncoding transcript	Het
Rabgap1	T	C	2: 37,532,519	S595P	probably damaging	Het
Rap1gap	T	C	4: 137,712,129	S126P	probably damaging	Het
Rgs6	A	T	12: 83,067,411		probably null	Het
Slc5a6	T	A	5: 31,036,884	K610*	probably null	Het
Sun5	C	T	2: 153,869,466	V27I	probably benign	Het
Tmco5b	T	C	2: 113,289,757	I126T	probably benign	Het
Tmed7	G	A	18: 46,593,413	Q92*	probably null	Het
Trav7d-2	A	G	14: 52,684,428	D98G	probably benign	Het
Trbv16	T	A	6: 41,152,002	L40Q	probably damaging	Het
Ush2a	T	C	1: 188,753,651	V2986A	probably benign	Het
Usp33	T	C	3: 152,358,673	V58A	probably benign	Het
Vmn2r94	T	A	17: 18,257,031	M373L	probably benign	Het
Ywhaq	T	C	12: 21,417,511		probably benign	Het
Zbbx	G	A	3: 75,081,747	H345Y	possibly damaging	Het
Zfp346	G	T	13: 55,113,813		probably benign	Het
Zfp616	C	T	11: 74,084,207	A434V	probably benign	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Olfr1285

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01328:Olfr1285	APN	2	111409219	missense	probably damaging	1.00
IGL01819:Olfr1285	APN	2	111408733	missense	probably damaging	0.99
IGL02109:Olfr1285	APN	2	111408493	exon	noncoding transcript
IGL02407:Olfr1285	APN	2	111408578	exon	noncoding transcript
R0054:Olfr1285	UTSW	2	111408795	missense	probably benign	0.00
R1665:Olfr1285	UTSW	2	111408753	missense	probably damaging	1.00
R2339:Olfr1285	UTSW	2	111409189	missense	probably benign	0.36
R3876:Olfr1285	UTSW	2	111408622	missense	possibly damaging	0.57
R4260:Olfr1285	UTSW	2	111408505	exon	noncoding transcript
R4439:Olfr1285	UTSW	2	111409308	exon	noncoding transcript
R4762:Olfr1285	UTSW	2	111408880	exon	noncoding transcript
R5120:Olfr1285	UTSW	2	111409240	exon	noncoding transcript
R5215:Olfr1285	UTSW	2	111409286	exon	noncoding transcript
R5244:Olfr1285	UTSW	2	111408554	exon	noncoding transcript
R5667:Olfr1285	UTSW	2	111408473	exon	noncoding transcript
R5671:Olfr1285	UTSW	2	111408473	exon	noncoding transcript
R5687:Olfr1285	UTSW	2	111408688	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- TGGCATTTTAGCAACGTATTCTTTC -3'
(R):5'- CAGTTAAGAATAGCTTGCAGAAATG -3'

Sequencing Primer
(F):5'- AGCAACGTATTCTTTCACTCTCTTAC -3'
(R):5'- CAAGTCAAGATGAGTCTAAATGG -3'

Posted On

2016-02-04