Incidental Mutation 'R4821:Rap1gap'
ID370213
Institutional Source Beutler Lab
Gene Symbol Rap1gap
Ensembl Gene ENSMUSG00000041351
Gene NameRap1 GTPase-activating protein
Synonyms1300019I11Rik, 2310004O14Rik, Rap1ga1
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4821 (G1)
Quality Score180
Status Validated
Chromosome4
Chromosomal Location137664726-137729861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137712129 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 126 (S126P)
Ref Sequence ENSEMBL: ENSMUSP00000115391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047243] [ENSMUST00000097837] [ENSMUST00000105835] [ENSMUST00000150928] [ENSMUST00000152567]
Predicted Effect probably benign
Transcript: ENSMUST00000047243
AA Change: S138P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000042473
Gene: ENSMUSG00000041351
AA Change: S138P

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 461 1.4e-64 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
low complexity region 680 695 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097837
AA Change: S105P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095448
Gene: ENSMUSG00000041351
AA Change: S105P

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
GoLoco 26 48 4.94e-10 SMART
Pfam:Rap_GAP 241 428 1.2e-64 PFAM
low complexity region 452 462 N/A INTRINSIC
low complexity region 597 608 N/A INTRINSIC
low complexity region 647 662 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105835
AA Change: S138P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000101461
Gene: ENSMUSG00000041351
AA Change: S138P

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 274 455 4.5e-66 PFAM
low complexity region 485 495 N/A INTRINSIC
low complexity region 630 641 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131536
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139831
Predicted Effect probably benign
Transcript: ENSMUST00000150928
SMART Domains Protein: ENSMUSP00000123561
Gene: ENSMUSG00000041351

DomainStartEndE-ValueType
GoLoco 59 81 4.94e-10 SMART
Pfam:Rap_GAP 199 241 1.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000152567
AA Change: S126P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115391
Gene: ENSMUSG00000041351
AA Change: S126P

DomainStartEndE-ValueType
GoLoco 47 69 4.94e-10 SMART
PDB:1SRQ|D 127 165 4e-20 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156683
Meta Mutation Damage Score 0.0976 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type of GTPase-activating-protein (GAP) that down-regulates the activity of the ras-related RAP1 protein. RAP1 acts as a molecular switch by cycling between an inactive GDP-bound form and an active GTP-bound form. The product of this gene, RAP1GAP, promotes the hydrolysis of bound GTP and hence returns RAP1 to the inactive state whereas other proteins, guanine nucleotide exchange factors (GEFs), act as RAP1 activators by facilitating the conversion of RAP1 from the GDP- to the GTP-bound form. In general, ras subfamily proteins, such as RAP1, play key roles in receptor-linked signaling pathways that control cell growth and differentiation. RAP1 plays a role in diverse processes such as cell proliferation, adhesion, differentiation, and embryogenesis. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Rap1gap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Rap1gap APN 4 137716524 missense probably damaging 0.98
IGL01810:Rap1gap APN 4 137716155 missense probably benign 0.07
IGL01944:Rap1gap APN 4 137725620 missense probably damaging 1.00
IGL02117:Rap1gap APN 4 137727044 missense probably damaging 0.98
IGL02271:Rap1gap APN 4 137718006 missense probably damaging 1.00
IGL02272:Rap1gap APN 4 137716566 missense probably damaging 1.00
IGL02590:Rap1gap APN 4 137720300 missense probably damaging 0.98
IGL02626:Rap1gap APN 4 137727053 missense probably benign 0.00
IGL03211:Rap1gap APN 4 137715846 critical splice donor site probably null
R0243:Rap1gap UTSW 4 137719351 missense probably damaging 0.99
R1239:Rap1gap UTSW 4 137717996 missense probably damaging 1.00
R1246:Rap1gap UTSW 4 137712094 missense possibly damaging 0.86
R2264:Rap1gap UTSW 4 137727723 missense probably benign
R2935:Rap1gap UTSW 4 137724731 missense probably benign 0.19
R3840:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R3841:Rap1gap UTSW 4 137717447 missense probably damaging 1.00
R4619:Rap1gap UTSW 4 137716111 missense probably damaging 1.00
R4998:Rap1gap UTSW 4 137728284 missense possibly damaging 0.80
R5061:Rap1gap UTSW 4 137720433 critical splice donor site probably null
R5800:Rap1gap UTSW 4 137720377 missense probably benign 0.00
R6259:Rap1gap UTSW 4 137681757 critical splice donor site probably null
R7082:Rap1gap UTSW 4 137718936 missense probably damaging 1.00
R7098:Rap1gap UTSW 4 137716082 splice site probably null
R7234:Rap1gap UTSW 4 137728540 nonsense probably null
R7580:Rap1gap UTSW 4 137719982 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGTCTAGGACCTCATAGCCCTG -3'
(R):5'- AGACTCAGAATTCTTAGATGCCC -3'

Sequencing Primer
(F):5'- GGCTGTCCAGTGTGTCC -3'
(R):5'- AGAATTCTTAGATGCCCCCTAGC -3'
Posted On2016-02-04