Incidental Mutation 'R4821:Slc5a6'
ID370215
Institutional Source Beutler Lab
Gene Symbol Slc5a6
Ensembl Gene ENSMUSG00000006641
Gene Namesolute carrier family 5 (sodium-dependent vitamin transporter), member 6
Synonyms
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4821 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31036036-31048924 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 31036884 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 610 (K610*)
Ref Sequence ENSEMBL: ENSMUSP00000143993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080431] [ENSMUST00000114668] [ENSMUST00000202520] [ENSMUST00000202556] [ENSMUST00000202984]
Predicted Effect probably null
Transcript: ENSMUST00000006817
AA Change: K610*
SMART Domains Protein: ENSMUSP00000006817
Gene: ENSMUSG00000006641
AA Change: K610*

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000080431
AA Change: K610*
SMART Domains Protein: ENSMUSP00000079291
Gene: ENSMUSG00000006641
AA Change: K610*

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114668
AA Change: K610*
SMART Domains Protein: ENSMUSP00000110316
Gene: ENSMUSG00000006641
AA Change: K610*

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201017
Predicted Effect probably null
Transcript: ENSMUST00000202520
AA Change: K610*
SMART Domains Protein: ENSMUSP00000143938
Gene: ENSMUSG00000006641
AA Change: K610*

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202556
AA Change: K610*
SMART Domains Protein: ENSMUSP00000143993
Gene: ENSMUSG00000006641
AA Change: K610*

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:SSF 58 462 7.9e-41 PFAM
low complexity region 496 506 N/A INTRINSIC
transmembrane domain 524 546 N/A INTRINSIC
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202984
SMART Domains Protein: ENSMUSP00000144349
Gene: ENSMUSG00000006641

DomainStartEndE-ValueType
Pfam:SSF 2 104 6.3e-15 PFAM
transmembrane domain 158 180 N/A INTRINSIC
Meta Mutation Damage Score 0.9653 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Slc5a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Slc5a6 APN 5 31038935 unclassified probably benign
IGL02305:Slc5a6 APN 5 31037835 missense probably benign 0.01
IGL02457:Slc5a6 APN 5 31040658 missense probably damaging 1.00
IGL02691:Slc5a6 APN 5 31042174 missense probably damaging 0.99
IGL02737:Slc5a6 APN 5 31037167 missense probably benign 0.01
IGL03277:Slc5a6 APN 5 31038028 missense possibly damaging 0.90
IGL03389:Slc5a6 APN 5 31037477 missense probably damaging 1.00
Burke UTSW 5 31036884 nonsense probably null
whig UTSW 5 31036811 missense probably damaging 1.00
F5770:Slc5a6 UTSW 5 31042613 unclassified probably null
R1177:Slc5a6 UTSW 5 31039302 critical splice donor site probably null
R1505:Slc5a6 UTSW 5 31037111 missense probably benign 0.00
R1680:Slc5a6 UTSW 5 31042644 missense probably damaging 1.00
R1800:Slc5a6 UTSW 5 31040676 nonsense probably null
R1881:Slc5a6 UTSW 5 31036811 missense probably damaging 1.00
R2216:Slc5a6 UTSW 5 31039335 missense possibly damaging 0.77
R3803:Slc5a6 UTSW 5 31042951 missense probably damaging 1.00
R4250:Slc5a6 UTSW 5 31037718 missense probably benign 0.00
R4765:Slc5a6 UTSW 5 31038083 missense possibly damaging 0.85
R5187:Slc5a6 UTSW 5 31042978 missense probably damaging 1.00
R5536:Slc5a6 UTSW 5 31043102 missense probably damaging 1.00
R5554:Slc5a6 UTSW 5 31038100 missense probably damaging 0.98
R5806:Slc5a6 UTSW 5 31040770 missense probably damaging 1.00
R6035:Slc5a6 UTSW 5 31048824 unclassified probably benign
R6035:Slc5a6 UTSW 5 31048824 unclassified probably benign
R6615:Slc5a6 UTSW 5 31036830 missense probably benign
R6621:Slc5a6 UTSW 5 31040778 missense probably damaging 0.98
R6983:Slc5a6 UTSW 5 31040405 missense probably benign
V7581:Slc5a6 UTSW 5 31042613 unclassified probably null
X0022:Slc5a6 UTSW 5 31043338 start codon destroyed probably null 0.97
Z1176:Slc5a6 UTSW 5 31038025 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAGGTCCTTTGCTGTAGGCC -3'
(R):5'- TCTAGCCGTTGCACTGTTGG -3'

Sequencing Primer
(F):5'- GGTCATCCACCTCAGCACTGTAG -3'
(R):5'- GGTTGTGTCTTCTGTGATCACCC -3'
Posted On2016-02-04