Incidental Mutation 'R4821:Aak1'
ID370219
Institutional Source Beutler Lab
Gene Symbol Aak1
Ensembl Gene ENSMUSG00000057230
Gene NameAP2 associated kinase 1
Synonyms5530400K14Rik, D6Ertd245e
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.564) question?
Stock #R4821 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86849517-87003223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 86850189 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 46 (V46A)
Ref Sequence ENSEMBL: ENSMUSP00000086948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003710] [ENSMUST00000089519] [ENSMUST00000204414]
Predicted Effect probably damaging
Transcript: ENSMUST00000003710
AA Change: V46A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003710
Gene: ENSMUSG00000057230
AA Change: V46A

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1.5e-27 PFAM
Pfam:Pkinase 46 312 7e-43 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 527 N/A INTRINSIC
low complexity region 571 588 N/A INTRINSIC
low complexity region 635 647 N/A INTRINSIC
low complexity region 712 730 N/A INTRINSIC
low complexity region 848 861 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089519
AA Change: V46A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086948
Gene: ENSMUSG00000057230
AA Change: V46A

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 1e-26 PFAM
Pfam:Pkinase 46 312 2.2e-44 PFAM
low complexity region 420 489 N/A INTRINSIC
low complexity region 494 510 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 566 608 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
low complexity region 716 728 N/A INTRINSIC
low complexity region 793 811 N/A INTRINSIC
low complexity region 929 942 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113668
SMART Domains Protein: ENSMUSP00000109298
Gene: ENSMUSG00000057230

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
Pfam:Pkinase_Tyr 46 310 3.5e-28 PFAM
Pfam:Pkinase 46 312 1.7e-43 PFAM
Pfam:Kinase-like 126 301 1.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156885
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185414
Predicted Effect probably damaging
Transcript: ENSMUST00000204414
AA Change: V46A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000145013
Gene: ENSMUSG00000057230
AA Change: V46A

DomainStartEndE-ValueType
low complexity region 12 33 N/A INTRINSIC
PDB:4C59|A 34 110 2e-8 PDB
Blast:S_TKc 48 110 1e-6 BLAST
SCOP:d1f3mc_ 50 109 2e-10 SMART
Meta Mutation Damage Score 0.5832 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor-related protein complex 2 (AP-2 complexes) functions during receptor-mediated endocytosis to trigger clathrin assembly, interact with membrane-bound receptors, and recruit encodytic accessory factors. This gene encodes a member of the SNF1 subfamily of Ser/Thr protein kinases. The protein interacts with and phosphorylates a subunit of the AP-2 complex, which promotes binding of AP-2 to sorting signals found in membrane-bound receptors and subsequent receptor endocytosis. Its kinase activity is stimulated by clathrin. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Aak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Aak1 APN 6 86946153 missense probably damaging 1.00
IGL01284:Aak1 APN 6 86850053 start codon destroyed possibly damaging 0.86
IGL01292:Aak1 APN 6 86949538 splice site probably benign
IGL01344:Aak1 APN 6 86946157 missense possibly damaging 0.49
IGL02317:Aak1 APN 6 86956300 missense possibly damaging 0.61
IGL02422:Aak1 APN 6 86982616 missense unknown
IGL02531:Aak1 APN 6 86956447 missense unknown
IGL02719:Aak1 APN 6 86959170 intron probably benign
IGL03051:Aak1 APN 6 86987301 utr 3 prime probably benign
R0382:Aak1 UTSW 6 86946919 missense probably benign 0.19
R0846:Aak1 UTSW 6 86959089 intron probably benign
R1074:Aak1 UTSW 6 86935439 missense probably damaging 0.97
R1141:Aak1 UTSW 6 86965476 critical splice acceptor site probably null
R1221:Aak1 UTSW 6 86965478 missense unknown
R1261:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1262:Aak1 UTSW 6 86935488 missense probably benign 0.09
R1470:Aak1 UTSW 6 86967355 missense unknown
R1470:Aak1 UTSW 6 86967355 missense unknown
R1931:Aak1 UTSW 6 86956336 missense unknown
R3713:Aak1 UTSW 6 86955190 missense probably benign 0.19
R3785:Aak1 UTSW 6 86965578 missense unknown
R3815:Aak1 UTSW 6 86959042 intron probably benign
R3816:Aak1 UTSW 6 86959042 intron probably benign
R3819:Aak1 UTSW 6 86959042 intron probably benign
R4165:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4166:Aak1 UTSW 6 86850062 missense probably damaging 1.00
R4351:Aak1 UTSW 6 86935537 splice site probably null
R4430:Aak1 UTSW 6 86986366 missense unknown
R4431:Aak1 UTSW 6 86986318 missense unknown
R4665:Aak1 UTSW 6 86925077 missense probably null 1.00
R5088:Aak1 UTSW 6 86944480 critical splice donor site probably null
R5543:Aak1 UTSW 6 86982645 critical splice donor site probably null
R5567:Aak1 UTSW 6 86955168 nonsense probably null
R5726:Aak1 UTSW 6 86925124 nonsense probably null
R6083:Aak1 UTSW 6 86963996 missense unknown
R6269:Aak1 UTSW 6 86964051 missense unknown
R6693:Aak1 UTSW 6 86965515 missense unknown
R6700:Aak1 UTSW 6 86964203 missense unknown
R6759:Aak1 UTSW 6 86944417 missense probably damaging 1.00
R6969:Aak1 UTSW 6 86981335 missense unknown
Y4335:Aak1 UTSW 6 86959142 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- ACCGGAGAAGAAATCCTTAGATC -3'
(R):5'- TCTCTCAAGGACAATGACTCGC -3'

Sequencing Primer
(F):5'- CCTAGAAACCATCGGCATTTTG -3'
(R):5'- TGACTCGCAAGGAAAGTGC -3'
Posted On2016-02-04