Incidental Mutation 'R0420:Tiam2'
ID37022
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission 038622-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0420 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3502918 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 83 (N83S)
Ref Sequence ENSEMBL: ENSMUSP00000154598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838] [ENSMUST00000227405] [ENSMUST00000227604]
Predicted Effect probably benign
Transcript: ENSMUST00000072156
AA Change: N1090S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: N1090S

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169838
AA Change: N1090S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: N1090S

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226997
Predicted Effect probably benign
Transcript: ENSMUST00000227405
AA Change: N83S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000227604
AA Change: N17S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0752 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 95.2%
Validation Efficiency 100% (76/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik A G 15: 98,571,094 S17G probably benign Het
Abcb4 T C 5: 8,941,050 V870A probably benign Het
Adam6b A T 12: 113,489,994 M144L probably benign Het
Adrb2 T A 18: 62,179,539 I72L possibly damaging Het
Ankrd53 A T 6: 83,763,692 H99L probably damaging Het
Ap4e1 C T 2: 127,049,360 T17M probably damaging Het
Arnt T A 3: 95,470,394 probably benign Het
Atp1a3 C T 7: 24,980,627 G884E probably benign Het
Atp6v1b1 T C 6: 83,752,844 probably benign Het
Atp8a2 G T 14: 59,773,744 T971K probably damaging Het
BC048562 A T 9: 108,445,966 T167S probably benign Het
Brd9 A G 13: 73,955,473 M491V probably benign Het
Btnl10 A T 11: 58,923,451 D319V probably damaging Het
Cadps T A 14: 12,491,800 R783S probably damaging Het
Ccdc149 A G 5: 52,400,239 probably benign Het
Ccm2l A T 2: 153,070,862 D107V probably null Het
Cep192 A G 18: 67,813,893 E213G possibly damaging Het
Cyp2c37 A C 19: 39,995,794 N242T probably benign Het
Dnah17 A G 11: 118,039,939 V3750A probably damaging Het
Ehbp1 T A 11: 22,151,836 I231L probably benign Het
Emilin3 A G 2: 160,910,879 probably benign Het
Eya4 T C 10: 23,155,963 N254S possibly damaging Het
Fam184b A G 5: 45,584,512 S126P probably damaging Het
Fancd2 T C 6: 113,536,979 L108P probably damaging Het
Fgf12 A T 16: 28,162,529 M145K possibly damaging Het
Gabbr1 A G 17: 37,046,762 N23S possibly damaging Het
Ggt1 T A 10: 75,576,213 probably benign Het
Gm1966 T A 7: 106,603,883 L51F probably damaging Het
Gm6434 T A 7: 25,882,361 noncoding transcript Het
Gm6614 T G 6: 141,985,477 probably benign Het
Grik4 A T 9: 42,622,096 L376* probably null Het
Gzf1 A G 2: 148,683,833 T75A probably benign Het
Hcn1 T C 13: 117,975,375 I625T unknown Het
Hhat C T 1: 192,552,934 probably null Het
Ifit1bl1 T C 19: 34,594,514 E181G probably damaging Het
Kif21a T C 15: 90,968,054 probably benign Het
Lrrc45 A C 11: 120,715,219 S118R probably damaging Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Ms4a5 A G 19: 11,283,654 L47S probably damaging Het
Mynn A T 3: 30,607,459 N230I probably benign Het
Nck2 T C 1: 43,554,118 S162P probably damaging Het
Nfat5 T C 8: 107,367,461 F259S probably damaging Het
Obox1 T G 7: 15,556,253 S174A possibly damaging Het
Ociad1 T A 5: 73,313,429 probably null Het
Pgbd1 A T 13: 21,423,166 V286E possibly damaging Het
Phlpp2 T C 8: 109,939,935 V1032A probably damaging Het
Ppm1e C T 11: 87,240,614 A318T probably damaging Het
Prex1 T A 2: 166,589,571 D757V probably benign Het
Ptpdc1 C A 13: 48,589,119 probably null Het
Rbbp5 T G 1: 132,493,844 I94R possibly damaging Het
Rnpc3 A G 3: 113,621,869 V173A probably benign Het
Sgsm1 A T 5: 113,263,759 N700K probably benign Het
Sox14 T A 9: 99,875,122 H188L probably damaging Het
Supt5 T A 7: 28,317,329 probably benign Het
Synpo A G 18: 60,602,418 S819P probably damaging Het
Tenm2 A G 11: 36,207,124 probably benign Het
Tenm4 T C 7: 96,873,766 V1468A possibly damaging Het
Tle6 T C 10: 81,595,311 probably benign Het
Tm2d2 T G 8: 25,018,114 N91K probably damaging Het
Tmem132d T G 5: 127,864,646 Q463H probably benign Het
Tmf1 A G 6: 97,176,141 S324P probably damaging Het
Tnc T C 4: 64,000,159 T1172A probably benign Het
Usp17lb A T 7: 104,840,539 C393S probably benign Het
Usp42 G A 5: 143,714,861 L1136F probably damaging Het
Vmn2r92 T G 17: 18,168,921 M499R probably benign Het
Vps54 T A 11: 21,311,071 probably benign Het
Wdr6 C T 9: 108,573,101 R1076H probably benign Het
Wdr72 T A 9: 74,210,757 M917K possibly damaging Het
Wee2 T C 6: 40,456,995 V281A probably benign Het
Zc3h6 A G 2: 129,014,827 D609G probably benign Het
Zfp345 G A 2: 150,473,243 H125Y possibly damaging Het
Zhx2 A G 15: 57,821,840 K202E probably damaging Het
Zic2 CCCACCACCACCATCACCACCACCACC CCCACCATCACCACCACCACC 14: 122,476,364 probably benign Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7151:Tiam2 UTSW 17 3448385 missense probably benign 0.36
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7925:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 intron probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTATTGGCCCTCGATCCATGTC -3'
(R):5'- GCAGCAATTTACCTCAGGGAGCAC -3'

Sequencing Primer
(F):5'- TCTTTGTGAGACTCCAGACTG -3'
(R):5'- ATTTACCTCAGGGAGCACATGTC -3'
Posted On2013-05-09