Incidental Mutation 'R4821:Dennd4a'
ID370227
Institutional Source Beutler Lab
Gene Symbol Dennd4a
Ensembl Gene ENSMUSG00000053641
Gene NameDENN/MADD domain containing 4A
SynonymsF730015K02Rik
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R4821 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location64811340-64919667 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 64897249 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1290 (C1290Y)
Ref Sequence ENSEMBL: ENSMUSP00000037915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038890]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038890
AA Change: C1290Y

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037915
Gene: ENSMUSG00000053641
AA Change: C1290Y

DomainStartEndE-ValueType
internal_repeat_1 45 93 3.26e-5 PROSPERO
uDENN 169 276 1.71e-28 SMART
DENN 309 493 2.4e-73 SMART
dDENN 559 633 4.15e-27 SMART
low complexity region 724 735 N/A INTRINSIC
low complexity region 936 950 N/A INTRINSIC
low complexity region 1176 1191 N/A INTRINSIC
low complexity region 1249 1262 N/A INTRINSIC
low complexity region 1402 1417 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216098
Meta Mutation Damage Score 0.0648 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DENN domain-containing protein that may function as a guanine nucleotide exchange factor that specifically activates ras-related protein Rab-10. This protein also contains a interferon stimulated response element-binding domain and may be involved in regulating the v-myc avian myelocytomatosis viral (MYC) oncogene. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 8. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Dennd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Dennd4a APN 9 64911762 missense probably damaging 1.00
IGL01610:Dennd4a APN 9 64906884 missense probably damaging 0.99
IGL01788:Dennd4a APN 9 64842621 missense probably benign 0.00
IGL01827:Dennd4a APN 9 64842561 nonsense probably null
IGL01828:Dennd4a APN 9 64842561 nonsense probably null
IGL01829:Dennd4a APN 9 64842561 nonsense probably null
IGL01979:Dennd4a APN 9 64894409 missense probably benign 0.00
IGL02100:Dennd4a APN 9 64909706 splice site probably benign
IGL02339:Dennd4a APN 9 64842561 nonsense probably null
IGL02341:Dennd4a APN 9 64842561 nonsense probably null
IGL02584:Dennd4a APN 9 64851298 missense probably damaging 1.00
IGL02607:Dennd4a APN 9 64862327 missense probably damaging 0.99
IGL02654:Dennd4a APN 9 64910191 splice site probably benign
IGL02701:Dennd4a APN 9 64897353 missense possibly damaging 0.50
IGL03051:Dennd4a APN 9 64862414 missense probably damaging 1.00
IGL03257:Dennd4a APN 9 64871874 missense possibly damaging 0.93
IGL03346:Dennd4a APN 9 64888526 missense possibly damaging 0.47
IGL03349:Dennd4a APN 9 64888974 missense probably damaging 1.00
IGL03398:Dennd4a APN 9 64871882 missense probably benign 0.32
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0010:Dennd4a UTSW 9 64896715 missense probably benign 0.00
R0129:Dennd4a UTSW 9 64893294 missense probably damaging 1.00
R0220:Dennd4a UTSW 9 64852445 missense probably damaging 1.00
R0396:Dennd4a UTSW 9 64862391 missense probably damaging 1.00
R0881:Dennd4a UTSW 9 64851383 critical splice donor site probably null
R1225:Dennd4a UTSW 9 64911675 missense probably benign 0.03
R1311:Dennd4a UTSW 9 64910004 missense probably benign 0.34
R1448:Dennd4a UTSW 9 64906045 missense possibly damaging 0.95
R1450:Dennd4a UTSW 9 64911665 missense probably benign 0.03
R1630:Dennd4a UTSW 9 64871882 missense probably benign 0.32
R1709:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R1824:Dennd4a UTSW 9 64859358 critical splice donor site probably null
R1851:Dennd4a UTSW 9 64862030 missense probably damaging 1.00
R1870:Dennd4a UTSW 9 64897234 missense probably benign 0.00
R1900:Dennd4a UTSW 9 64897336 missense probably damaging 0.99
R1911:Dennd4a UTSW 9 64889086 missense probably damaging 1.00
R1938:Dennd4a UTSW 9 64842490 missense probably damaging 1.00
R1954:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R1955:Dennd4a UTSW 9 64852467 missense probably benign 0.02
R2049:Dennd4a UTSW 9 64889605 missense possibly damaging 0.92
R2129:Dennd4a UTSW 9 64905974 splice site probably null
R2138:Dennd4a UTSW 9 64889337 missense probably damaging 1.00
R2929:Dennd4a UTSW 9 64852417 missense possibly damaging 0.85
R3083:Dennd4a UTSW 9 64906081 missense probably benign 0.03
R3108:Dennd4a UTSW 9 64912387 missense probably benign 0.23
R3176:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3177:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3276:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3277:Dennd4a UTSW 9 64888993 missense probably damaging 1.00
R3890:Dennd4a UTSW 9 64872028 missense probably damaging 1.00
R3953:Dennd4a UTSW 9 64852575 missense probably damaging 1.00
R3963:Dennd4a UTSW 9 64862331 missense probably damaging 1.00
R4059:Dennd4a UTSW 9 64911892 missense possibly damaging 0.92
R4499:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4500:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4501:Dennd4a UTSW 9 64910123 missense possibly damaging 0.78
R4671:Dennd4a UTSW 9 64894407 missense probably benign
R4701:Dennd4a UTSW 9 64897357 missense possibly damaging 0.91
R4829:Dennd4a UTSW 9 64889056 missense probably damaging 1.00
R4876:Dennd4a UTSW 9 64896590 missense probably benign
R4881:Dennd4a UTSW 9 64838844 missense possibly damaging 0.77
R4962:Dennd4a UTSW 9 64906003 missense probably benign 0.00
R5225:Dennd4a UTSW 9 64888928 missense possibly damaging 0.94
R5557:Dennd4a UTSW 9 64904227 missense probably benign 0.07
R5649:Dennd4a UTSW 9 64851209 splice site probably null
R5868:Dennd4a UTSW 9 64896729 missense probably benign 0.02
R5876:Dennd4a UTSW 9 64911755 missense probably damaging 1.00
R6052:Dennd4a UTSW 9 64886945 missense probably damaging 1.00
R6411:Dennd4a UTSW 9 64871899 missense probably benign 0.04
R6596:Dennd4a UTSW 9 64852420 missense probably damaging 1.00
R6668:Dennd4a UTSW 9 64886965 missense probably damaging 1.00
R6915:Dennd4a UTSW 9 64852489 nonsense probably null
R7056:Dennd4a UTSW 9 64906923 missense possibly damaging 0.89
R7107:Dennd4a UTSW 9 64894399 missense possibly damaging 0.79
R7203:Dennd4a UTSW 9 64896474 missense probably benign 0.05
R7238:Dennd4a UTSW 9 64861956 missense probably damaging 1.00
R7373:Dennd4a UTSW 9 64897269 missense probably benign 0.01
R7454:Dennd4a UTSW 9 64852570 missense probably damaging 1.00
R7546:Dennd4a UTSW 9 64873044 missense probably damaging 1.00
R7590:Dennd4a UTSW 9 64888587 missense probably benign 0.01
R7662:Dennd4a UTSW 9 64852431 missense probably damaging 1.00
R7782:Dennd4a UTSW 9 64906920 missense probably damaging 0.98
R7909:Dennd4a UTSW 9 64872993 critical splice acceptor site probably null
R7976:Dennd4a UTSW 9 64852512 missense possibly damaging 0.95
R8026:Dennd4a UTSW 9 64873030 missense probably damaging 1.00
R8034:Dennd4a UTSW 9 64888568 missense probably benign 0.01
R8089:Dennd4a UTSW 9 64849175 missense probably damaging 1.00
R8298:Dennd4a UTSW 9 64906875 missense probably benign 0.00
R8397:Dennd4a UTSW 9 64889109 missense probably benign
R8425:Dennd4a UTSW 9 64838974 missense probably damaging 1.00
R8495:Dennd4a UTSW 9 64886879 missense probably damaging 1.00
X0026:Dennd4a UTSW 9 64897320 missense possibly damaging 0.67
Z1088:Dennd4a UTSW 9 64872022 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGCAGTCCTTTGACAAGC -3'
(R):5'- ACGTAGTGTACATGGTGAACC -3'

Sequencing Primer
(F):5'- CCAGCATTGATTTACAACGAGCATG -3'
(R):5'- GTACATGGTGAACCTTGAGTACC -3'
Posted On2016-02-04