Incidental Mutation 'R4821:Mcu'
ID370230
Institutional Source Beutler Lab
Gene Symbol Mcu
Ensembl Gene ENSMUSG00000009647
Gene Namemitochondrial calcium uniporter
Synonyms2010012O16Rik, Ccdc109a, D130073L02Rik
MMRRC Submission 042437-MU
Accession Numbers

Genbank: NM_001033259; MGI: 3026965

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4821 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location59446984-59616692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59467689 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 109 (V109M)
Ref Sequence ENSEMBL: ENSMUSP00000020312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020312]
Predicted Effect probably damaging
Transcript: ENSMUST00000020312
AA Change: V109M

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020312
Gene: ENSMUSG00000009647
AA Change: V109M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 66 77 N/A INTRINSIC
Pfam:MCU 114 319 3.5e-78 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a calcium transporter that localizes to the mitochondrial inner membrane. The encoded protein interacts with mitochondrial calcium uptake 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit impaired calcium-induced permeability transition pore opening, decreased body size and weight, decreased exercise endurance and decreased grip strength. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Acaca A G 11: 84,294,987 D116G possibly damaging Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Mcu
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:Mcu APN 10 59467644 missense probably damaging 1.00
IGL03074:Mcu APN 10 59467758 missense probably damaging 0.99
R0201:Mcu UTSW 10 59456677 missense probably damaging 1.00
R0445:Mcu UTSW 10 59456645 splice site probably benign
R1256:Mcu UTSW 10 59454968 missense probably damaging 1.00
R1497:Mcu UTSW 10 59448848 missense probably damaging 1.00
R2322:Mcu UTSW 10 59454944 critical splice donor site probably null
R2404:Mcu UTSW 10 59467704 missense probably damaging 1.00
R4517:Mcu UTSW 10 59467634 missense probably damaging 1.00
R4666:Mcu UTSW 10 59456699 missense probably damaging 1.00
R5940:Mcu UTSW 10 59456732 missense possibly damaging 0.94
R6949:Mcu UTSW 10 59456744 missense possibly damaging 0.94
R8054:Mcu UTSW 10 59454995 missense probably damaging 1.00
RF007:Mcu UTSW 10 59491116 missense probably benign 0.00
Z1177:Mcu UTSW 10 59456771 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GTCTTCCATGCTTGCAAACC -3'
(R):5'- CTTGAATGAGCCTGTTCCCAG -3'

Sequencing Primer
(F):5'- GTCTTCCATGCTTGCAAACCAAAAC -3'
(R):5'- GAATGAGCCTGTTCCCAGATTAACTC -3'
Posted On2016-02-04