Mutagenetix > Incidental Mutations

Incidental Mutation 'R4821:Obscn'

370234

Institutional Source

Beutler Lab

Gene Symbol

Obscn

Ensembl Gene

ENSMUSG00000061462

Gene Name

obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Synonyms

OTTMUSG00000005786, LOC380698

MMRRC Submission

042437-MU

Accession Numbers

Genbank: NM_001171512.1, NM_199152.2; MGI: 2681862

Is this an essential gene?

Possibly essential (E-score: 0.730) question?

Stock #

R4821 (G1)

Quality Score

197

Status

Validated

Chromosome

Chromosomal Location

58994256-59136402 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 59040467 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 5781 (M5781K)

Ref Sequence

ENSEMBL: ENSMUSP00000020732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020732] [ENSMUST00000047441] [ENSMUST00000052872]

Predicted Effect

probably damaging
Transcript: ENSMUST00000020732
AA Change: M5781K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020732
Gene: ENSMUSG00000061462
AA Change: M5781K

Domain	Start	End	E-Value	Type
IGc2	21	88	8e-12	SMART
IGc2	121	190	8.31e-10	SMART
low complexity region	191	207	N/A	INTRINSIC
IGc2	248	316	4.63e-8	SMART
IG	337	417	5.32e-8	SMART
IG_like	425	506	1.5e2	SMART
FN3	510	596	2.11e-9	SMART
IG	711	790	2.39e-1	SMART
IGc2	876	942	4.49e-6	SMART
IGc2	968	1034	2.54e-5	SMART
IGc2	1060	1126	2.54e-5	SMART
IGc2	1152	1218	4.49e-6	SMART
IGc2	1244	1310	7.82e-6	SMART
IGc2	1336	1402	5.16e-6	SMART
IGc2	1428	1494	1.93e-5	SMART
IGc2	1520	1586	1.93e-5	SMART
IGc2	1612	1678	1.93e-5	SMART
IGc2	1704	1770	1.93e-5	SMART
IGc2	1796	1862	1.93e-5	SMART
IGc2	1888	1954	1.93e-5	SMART
IGc2	1980	2046	7.94e-7	SMART
IGc2	2072	2138	6.35e-6	SMART
IG	2158	2238	5.37e-4	SMART
IG	2248	2327	9.93e-8	SMART
IG	2338	2417	2.48e-8	SMART
IG	2427	2506	3.89e-1	SMART
IG	2516	2595	1.92e0	SMART
IG	2605	2683	6.45e-7	SMART
IG	2728	2807	1.22e-7	SMART
IGc2	2913	2979	9.93e-8	SMART
low complexity region	2981	2992	N/A	INTRINSIC
IG	2996	3075	2.44e0	SMART
IGc2	3091	3157	2.1e-6	SMART
IG	3174	3255	2.86e0	SMART
IGc2	3271	3337	8.38e-6	SMART
IG	3354	3433	1.2e-6	SMART
IG	3443	3524	1.42e-3	SMART
IGc2	3540	3606	3.85e-5	SMART
IGc2	3629	3695	3.13e-5	SMART
IGc2	3718	3783	3.3e-4	SMART
IGc2	3806	3871	5.84e-5	SMART
IGc2	3894	3959	1.29e-6	SMART
IG_like	3982	4047	5.5e-1	SMART
IGc2	4054	4119	1.46e-5	SMART
IGc2	4142	4207	1.25e-4	SMART
IGc2	4230	4295	1.56e-5	SMART
IGc2	4318	4383	1.19e-5	SMART
IG_like	4400	4479	2.1e1	SMART
IGc2	4495	4560	1.93e-5	SMART
IGc2	4583	4648	3.91e-6	SMART
IG	4665	4743	1.85e-7	SMART
IG	4753	4831	1.03e-5	SMART
IGc2	4847	4912	5.08e-5	SMART
IGc2	4935	5001	5.08e-5	SMART
IGc2	5024	5090	1.11e-5	SMART
IGc2	5113	5181	6.71e-5	SMART
IG	5198	5280	2.06e-5	SMART
low complexity region	5307	5321	N/A	INTRINSIC
IG	5377	5459	1.04e-1	SMART
IG	5469	5551	9.12e-7	SMART
FN3	5554	5636	2.44e-14	SMART
IG	5658	5740	3.68e-2	SMART
IQ	5900	5922	3.65e-4	SMART
IGc2	5939	6007	8.72e-4	SMART
low complexity region	6015	6031	N/A	INTRINSIC
low complexity region	6032	6048	N/A	INTRINSIC
low complexity region	6051	6074	N/A	INTRINSIC
IGc2	6169	6237	3.25e-12	SMART
low complexity region	6250	6266	N/A	INTRINSIC
IG	6296	6380	1.55e0	SMART
IGc2	6412	6485	1.82e-6	SMART
low complexity region	6599	6629	N/A	INTRINSIC
SH3	6632	6695	1.22e0	SMART
Pfam:RhoGEF	6726	6904	2.8e-22	PFAM
PH	6925	7035	2.74e-11	SMART
IGc2	7055	7123	3.73e-12	SMART
IGc2	7149	7218	1.18e-14	SMART
low complexity region	7259	7273	N/A	INTRINSIC
low complexity region	7274	7301	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047441
AA Change: M4978K

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038264
Gene: ENSMUSG00000061462
AA Change: M4978K

Domain	Start	End	E-Value	Type
IGc2	21	88	8e-12	SMART
IGc2	121	190	8.31e-10	SMART
low complexity region	191	207	N/A	INTRINSIC
IGc2	248	316	4.63e-8	SMART
IG	337	417	5.32e-8	SMART
IG_like	425	506	1.5e2	SMART
FN3	510	596	2.11e-9	SMART
IG	711	790	2.39e-1	SMART
IGc2	876	942	2.54e-5	SMART
IGc2	968	1034	2.54e-5	SMART
IGc2	1060	1126	4.49e-6	SMART
IGc2	1152	1218	7.82e-6	SMART
IGc2	1244	1310	5.16e-6	SMART
IGc2	1336	1402	1.93e-5	SMART
IGc2	1428	1494	1.93e-5	SMART
IGc2	1520	1586	1.93e-5	SMART
IGc2	1612	1678	1.93e-5	SMART
IGc2	1704	1770	1.93e-5	SMART
IGc2	1796	1862	7.94e-7	SMART
IG	1882	1962	5.37e-4	SMART
IG	1972	2051	9.93e-8	SMART
IG	2062	2141	2.48e-8	SMART
IG	2151	2230	3.89e-1	SMART
IG	2240	2319	1.92e0	SMART
IG	2329	2407	6.45e-7	SMART
IG	2452	2531	1.22e-7	SMART
IGc2	2637	2703	9.93e-8	SMART
low complexity region	2705	2716	N/A	INTRINSIC
IG	2720	2799	2.44e0	SMART
IGc2	2815	2881	2.1e-6	SMART
IG	2898	2979	2.86e0	SMART
IGc2	2995	3061	8.38e-6	SMART
IG	3078	3157	1.2e-6	SMART
IG	3167	3248	1.42e-3	SMART
IGc2	3264	3330	3.85e-5	SMART
IGc2	3353	3419	3.13e-5	SMART
IGc2	3442	3507	3.3e-4	SMART
IGc2	3530	3595	5.84e-5	SMART
IGc2	3618	3683	1.29e-6	SMART
IG_like	3706	3771	3.16e-1	SMART
IGc2	3779	3844	1.46e-5	SMART
IGc2	3867	3932	1.56e-5	SMART
IGc2	3955	4020	1.19e-5	SMART
IGc2	4043	4108	1.93e-5	SMART
IG	4125	4203	1.85e-7	SMART
IGc2	4219	4285	5.08e-5	SMART
IGc2	4308	4374	1.11e-5	SMART
IGc2	4397	4465	6.71e-5	SMART
IG	4482	4564	2.06e-5	SMART
IG	4574	4655	5.01e-4	SMART
IG	4664	4746	1.04e-1	SMART
FN3	4749	4831	2.44e-14	SMART
IG	4858	4940	3.68e-2	SMART
IQ	5100	5122	3.65e-4	SMART
IGc2	5139	5207	8.72e-4	SMART
low complexity region	5215	5231	N/A	INTRINSIC
low complexity region	5232	5248	N/A	INTRINSIC
low complexity region	5251	5274	N/A	INTRINSIC
IGc2	5369	5437	3.25e-12	SMART
low complexity region	5450	5466	N/A	INTRINSIC
IG	5496	5580	1.55e0	SMART
IGc2	5612	5685	1.82e-6	SMART
low complexity region	5799	5829	N/A	INTRINSIC
SH3	5832	5895	1.22e0	SMART
Pfam:RhoGEF	5926	6104	4.5e-21	PFAM
PH	6125	6235	2.74e-11	SMART
IGc2	6255	6323	3.73e-12	SMART
IGc2	6349	6418	1.18e-14	SMART
IGc2	6464	6531	1.7e-6	SMART
S_TKc	6562	6815	1.66e-79	SMART
Blast:STYKc	6843	6935	5e-39	BLAST
low complexity region	6939	6954	N/A	INTRINSIC
low complexity region	7013	7029	N/A	INTRINSIC
low complexity region	7146	7161	N/A	INTRINSIC
low complexity region	7199	7219	N/A	INTRINSIC
low complexity region	7499	7514	N/A	INTRINSIC
IGc2	7538	7606	6.3e-10	SMART
FN3	7620	7698	9.33e-2	SMART
STYKc	7736	7988	8.55e-41	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000052872
AA Change: M5631K

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000049737
Gene: ENSMUSG00000061462
AA Change: M5631K

Domain	Start	End	E-Value	Type
IGc2	21	88	8e-12	SMART
IGc2	121	190	8.31e-10	SMART
low complexity region	191	207	N/A	INTRINSIC
IGc2	248	316	4.63e-8	SMART
IG	337	417	5.32e-8	SMART
IG_like	425	506	1.5e2	SMART
FN3	510	596	2.11e-9	SMART
IG	711	790	2.39e-1	SMART
IGc2	809	875	4.49e-6	SMART
IGc2	901	967	2.54e-5	SMART
IGc2	993	1059	2.54e-5	SMART
IGc2	1085	1151	4.49e-6	SMART
IGc2	1177	1243	7.82e-6	SMART
IGc2	1269	1335	5.16e-6	SMART
IGc2	1361	1427	1.93e-5	SMART
IGc2	1453	1519	1.93e-5	SMART
IGc2	1545	1611	1.93e-5	SMART
IGc2	1637	1703	1.93e-5	SMART
IGc2	1729	1795	1.93e-5	SMART
IGc2	1821	1887	1.93e-5	SMART
IGc2	1913	1979	7.94e-7	SMART
IGc2	2005	2071	6.35e-6	SMART
IG	2091	2171	5.37e-4	SMART
IG	2181	2260	9.93e-8	SMART
IG	2271	2350	2.48e-8	SMART
IG	2360	2439	3.89e-1	SMART
IG	2449	2528	1.92e0	SMART
IG	2538	2616	6.45e-7	SMART
IG	2661	2740	1.22e-7	SMART
IGc2	2846	2912	9.93e-8	SMART
low complexity region	2914	2925	N/A	INTRINSIC
IG	2929	3008	2.44e0	SMART
IGc2	3024	3090	2.1e-6	SMART
IG	3107	3188	2.86e0	SMART
IGc2	3204	3270	8.38e-6	SMART
IG	3287	3366	1.2e-6	SMART
IG	3376	3457	1.42e-3	SMART
IGc2	3473	3539	3.85e-5	SMART
IGc2	3562	3628	3.13e-5	SMART
IGc2	3651	3716	3.3e-4	SMART
IGc2	3739	3804	5.84e-5	SMART
IGc2	3827	3892	1.29e-6	SMART
IG_like	3915	3980	3.16e-1	SMART
IGc2	3988	4053	1.46e-5	SMART
IGc2	4076	4141	1.25e-4	SMART
IGc2	4164	4229	1.56e-5	SMART
IGc2	4252	4317	1.19e-5	SMART
IGc2	4340	4405	1.93e-5	SMART
IGc2	4428	4493	3.91e-6	SMART
IG	4510	4588	1.85e-7	SMART
IG	4598	4676	1.03e-5	SMART
IGc2	4692	4757	5.08e-5	SMART
IGc2	4780	4846	5.08e-5	SMART
IGc2	4869	4935	1.11e-5	SMART
IGc2	4958	5026	6.71e-5	SMART
IG	5043	5125	2.06e-5	SMART
IG	5135	5216	5.01e-4	SMART
IG	5225	5307	1.04e-1	SMART
IG	5317	5399	9.12e-7	SMART
FN3	5402	5484	2.44e-14	SMART
IG	5511	5593	3.68e-2	SMART
IQ	5753	5775	3.65e-4	SMART
IGc2	5792	5860	8.72e-4	SMART
low complexity region	5868	5884	N/A	INTRINSIC
low complexity region	5885	5901	N/A	INTRINSIC
low complexity region	5904	5927	N/A	INTRINSIC
IGc2	6022	6090	3.25e-12	SMART
low complexity region	6103	6119	N/A	INTRINSIC
IG	6149	6233	1.55e0	SMART
IGc2	6265	6338	1.82e-6	SMART
low complexity region	6452	6482	N/A	INTRINSIC
SH3	6485	6548	1.22e0	SMART
Pfam:RhoGEF	6579	6757	2.1e-21	PFAM
PH	6778	6888	2.74e-11	SMART
IGc2	6908	6976	3.73e-12	SMART
IGc2	7002	7071	1.18e-14	SMART
low complexity region	7112	7126	N/A	INTRINSIC
low complexity region	7127	7154	N/A	INTRINSIC

Meta Mutation Damage Score

0.1499

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.5%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: The obscurin gene spans more than 150 kb, contains over 80 exons and encodes a protein of approximately 800 kDa. The encoded protein contains 68 Ig domains, 2 fibronectin domains, 1 calcium/calmodulin-binding domain, 1 RhoGEF domain with an associated PH domain, and 2 serine-threonine kinase domains. This protein is one of three giant sacromeric signaling proteins that includes titin and nebulin. It may have a role in the organization of myofibrils during assembly and also may mediate interactions between the sarcoplasmic reticulum and myofibrils. Alternatively spliced transcript variants encoding different isoforms have been described although the full-length nature is not known for all splicing variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit centrally localized nuclei in muscle fibers and mild myopathy in aged mice. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921539E11Rik	T	C	4: 103,235,674	K150R	probably damaging	Het
4930430A15Rik	T	C	2: 111,204,145		probably null	Het
Aak1	T	C	6: 86,850,189	V46A	probably damaging	Het
Abcb9	T	C	5: 124,090,149	T10A	probably benign	Het
Acaca	A	G	11: 84,294,987	D116G	possibly damaging	Het
Adam33	G	A	2: 131,061,195	P43L	probably benign	Het
Adamtsl2	T	A	2: 27,098,592		probably null	Het
Akap13	A	G	7: 75,677,507		probably benign	Het
Art1	T	A	7: 102,107,178	L192Q	probably damaging	Het
Baalc	A	G	15: 38,933,180		probably benign	Het
Baz2a	A	G	10: 128,111,109	E164G	probably damaging	Het
Bcs1l	A	G	1: 74,591,985	I391V	probably benign	Het
Cacna1c	T	C	6: 118,696,425	T497A	probably damaging	Het
Cap2	C	A	13: 46,610,110	T164N	probably damaging	Het
Ccdc173	T	C	2: 69,782,108	E96G	possibly damaging	Het
Ccdc57	A	G	11: 120,860,399		probably null	Het
Ccdc88c	T	C	12: 100,938,079	N1120S	probably benign	Het
Chd7	T	A	4: 8,844,706	V1605D	probably damaging	Het
Col12a1	A	T	9: 79,715,340		probably benign	Het
Commd3	T	C	2: 18,672,528	S22P	probably benign	Het
Cpd	T	C	11: 76,846,237	I244V	probably benign	Het
Cpeb2	C	A	5: 43,233,474		probably benign	Het
Cyp2c65	A	G	19: 39,072,191	D165G	probably damaging	Het
Ddx1	T	C	12: 13,239,147	Y152C	probably damaging	Het
Dennd4a	G	A	9: 64,897,249	C1290Y	possibly damaging	Het
Ebf4	G	A	2: 130,307,045	M232I	probably benign	Het
Farp2	A	G	1: 93,574,470		probably null	Het
Frk	T	C	10: 34,484,237	V78A	probably benign	Het
Gm5799	A	G	14: 43,544,641	D90G	probably damaging	Het
Gpr45	C	G	1: 43,030,453		probably benign	Het
Hfm1	C	T	5: 106,854,740		probably null	Het
Igkv4-57-1	T	A	6: 69,544,403	D105V	probably damaging	Het
Impdh2-ps	A	G	8: 100,031,363		noncoding transcript	Het
Kctd4	G	A	14: 75,962,777	V63I	probably benign	Het
Lcn6	T	A	2: 25,680,810	L137M	probably damaging	Het
Lonrf1	T	C	8: 36,219,972	N737D	probably benign	Het
Mcu	C	T	10: 59,467,689	V109M	probably damaging	Het
Mecom	C	A	3: 29,985,351	K186N	probably damaging	Het
Muc4	T	C	16: 32,753,802	I1226T	probably benign	Het
Mybpc1	T	C	10: 88,548,865	D533G	probably damaging	Het
Nae1	A	C	8: 104,519,784	C294G	probably damaging	Het
Ncapg2	T	G	12: 116,415,457	H190Q	probably damaging	Het
Nkx2-2	A	T	2: 147,185,843	L59Q	possibly damaging	Het
Nrxn3	C	T	12: 90,204,709	T295I	probably damaging	Het
Olfr1285	T	C	2: 111,409,225		noncoding transcript	Het
Olfr1427	T	A	19: 12,098,746	M298L	probably benign	Het
Olfr739	A	G	14: 50,424,749	T77A	possibly damaging	Het
Pcdhb6	C	A	18: 37,334,328	P101T	probably damaging	Het
Pot1b	A	G	17: 55,672,885	S324P	possibly damaging	Het
Ppcdc	C	T	9: 57,434,911	V43I	probably benign	Het
Prr13	A	T	15: 102,460,685		probably benign	Het
Rab10os	T	A	12: 3,237,322		noncoding transcript	Het
Rabgap1	T	C	2: 37,532,519	S595P	probably damaging	Het
Rap1gap	T	C	4: 137,712,129	S126P	probably damaging	Het
Rgs6	A	T	12: 83,067,411		probably null	Het
Slc5a6	T	A	5: 31,036,884	K610*	probably null	Het
Sun5	C	T	2: 153,869,466	V27I	probably benign	Het
Tmco5b	T	C	2: 113,289,757	I126T	probably benign	Het
Tmed7	G	A	18: 46,593,413	Q92*	probably null	Het
Trav7d-2	A	G	14: 52,684,428	D98G	probably benign	Het
Trbv16	T	A	6: 41,152,002	L40Q	probably damaging	Het
Ush2a	T	C	1: 188,753,651	V2986A	probably benign	Het
Usp33	T	C	3: 152,358,673	V58A	probably benign	Het
Vmn2r94	T	A	17: 18,257,031	M373L	probably benign	Het
Ywhaq	T	C	12: 21,417,511		probably benign	Het
Zbbx	G	A	3: 75,081,747	H345Y	possibly damaging	Het
Zfp346	G	T	13: 55,113,813		probably benign	Het
Zfp616	C	T	11: 74,084,207	A434V	probably benign	Het
Zfp992	C	T	4: 146,467,519	H566Y	probably damaging	Het

Other mutations in Obscn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00160:Obscn	APN	11	59002057	missense	probably benign	0.01
IGL00417:Obscn	APN	11	59006788	missense	unknown
IGL01018:Obscn	APN	11	59128069	missense	probably damaging	0.99
IGL01083:Obscn	APN	11	59036093	missense	probably damaging	0.99
IGL01109:Obscn	APN	11	59133762	missense	probably damaging	1.00
IGL01139:Obscn	APN	11	59078352	missense	probably damaging	1.00
IGL01361:Obscn	APN	11	59028889	missense	probably damaging	0.99
IGL01370:Obscn	APN	11	58995563	critical splice acceptor site	probably null
IGL01409:Obscn	APN	11	59031058	missense	probably damaging	1.00
IGL01432:Obscn	APN	11	59033757	missense	probably benign	0.27
IGL01527:Obscn	APN	11	59064417	missense	possibly damaging	0.83
IGL01543:Obscn	APN	11	59042117	missense	probably benign	0.01
IGL01578:Obscn	APN	11	58999680	missense	unknown
IGL01603:Obscn	APN	11	59037805	missense	probably damaging	1.00
IGL01750:Obscn	APN	11	59031639	missense	probably damaging	1.00
IGL01765:Obscn	APN	11	59115784	missense	possibly damaging	0.58
IGL01805:Obscn	APN	11	59132596	missense	probably damaging	0.99
IGL01816:Obscn	APN	11	58995779	splice site	probably benign
IGL01885:Obscn	APN	11	59074968	missense	possibly damaging	0.60
IGL01911:Obscn	APN	11	59008595	nonsense	probably null
IGL01963:Obscn	APN	11	59020541	missense	probably benign	0.16
IGL02012:Obscn	APN	11	59076507	missense	probably benign	0.03
IGL02096:Obscn	APN	11	59080704	missense	probably damaging	0.98
IGL02125:Obscn	APN	11	59093326	missense	possibly damaging	0.95
IGL02125:Obscn	APN	11	59022362	missense	probably damaging	1.00
IGL02203:Obscn	APN	11	59082308	missense	probably damaging	1.00
IGL02232:Obscn	APN	11	59038978	missense	probably damaging	0.97
IGL02262:Obscn	APN	11	59028533	missense	possibly damaging	0.88
IGL02304:Obscn	APN	11	59076622	missense	probably damaging	1.00
IGL02306:Obscn	APN	11	58999671	missense	unknown
IGL02323:Obscn	APN	11	59008522	missense	possibly damaging	0.51
IGL02341:Obscn	APN	11	59135825	missense	probably benign	0.09
IGL02342:Obscn	APN	11	59001088	missense	probably benign	0.00
IGL02352:Obscn	APN	11	59001027	missense	probably benign	0.10
IGL02397:Obscn	APN	11	59076899	missense	possibly damaging	0.67
IGL02405:Obscn	APN	11	59132602	missense	probably damaging	0.96
IGL02427:Obscn	APN	11	59067162	missense	probably damaging	1.00
IGL02479:Obscn	APN	11	59056227	splice site	probably benign
IGL02512:Obscn	APN	11	59028517	missense	probably damaging	1.00
IGL02566:Obscn	APN	11	59068147	missense	probably damaging	1.00
IGL02613:Obscn	APN	11	59002132	missense	probably benign	0.03
IGL02634:Obscn	APN	11	59054785	missense	probably damaging	1.00
IGL02680:Obscn	APN	11	59000020	missense	unknown
IGL02715:Obscn	APN	11	59080311	missense	probably benign	0.25
IGL02718:Obscn	APN	11	59077858	missense	probably damaging	1.00
IGL02723:Obscn	APN	11	59124620	missense	probably benign	0.17
IGL02735:Obscn	APN	11	59093349	missense	probably damaging	1.00
IGL02951:Obscn	APN	11	58994513	splice site	probably benign
IGL03004:Obscn	APN	11	59028587	missense	probably damaging	1.00
IGL03078:Obscn	APN	11	59078798	splice site	probably null
IGL03114:Obscn	APN	11	59000539	missense	unknown
IGL03125:Obscn	APN	11	59061648	missense	probably damaging	1.00
IGL03150:Obscn	APN	11	59051723	missense	probably damaging	1.00
IGL03156:Obscn	APN	11	59054896	missense	probably damaging	1.00
IGL03169:Obscn	APN	11	59073296	missense	probably damaging	1.00
IGL03297:Obscn	APN	11	59060886	missense	possibly damaging	0.83
IGL03326:Obscn	APN	11	59032902	missense	probably damaging	1.00
IGL03345:Obscn	APN	11	58995482	unclassified	probably benign
IGL03348:Obscn	APN	11	59050362	missense	probably damaging	1.00
IGL03355:Obscn	APN	11	59037792	missense	probably damaging	1.00
IGL03377:Obscn	APN	11	58999873	missense	probably damaging	1.00
IGL03396:Obscn	APN	11	59073578	missense	probably benign	0.12
IGL03405:Obscn	APN	11	59000124	missense	unknown
Bull	UTSW	11	59032918	missense	possibly damaging	0.85
ducking	UTSW	11	59080969	unclassified	probably benign
Goose	UTSW	11	59050480	missense	probably benign	0.23
Obscurity	UTSW	11	58994700	nonsense	probably null
Tallow	UTSW	11	59076993	missense	possibly damaging	0.95
BB001:Obscn	UTSW	11	59112555	missense	probably benign	0.27
BB002:Obscn	UTSW	11	59112555	missense	probably benign	0.27
BB011:Obscn	UTSW	11	59112555	missense	probably benign	0.27
BB012:Obscn	UTSW	11	59112555	missense	probably benign	0.27
IGL02802:Obscn	UTSW	11	59000484	missense	unknown
N/A - 535:Obscn	UTSW	11	59000308	missense	possibly damaging	0.67
PIT4131001:Obscn	UTSW	11	59067064	critical splice donor site	probably null
PIT4453001:Obscn	UTSW	11	59060976	missense	probably damaging	1.00
PIT4453001:Obscn	UTSW	11	59069834	missense	possibly damaging	0.76
PIT4504001:Obscn	UTSW	11	59133122	missense	probably damaging	1.00
PIT4651001:Obscn	UTSW	11	59041681	missense	probably damaging	0.99
R0033:Obscn	UTSW	11	58994746	unclassified	probably benign
R0041:Obscn	UTSW	11	59043977	missense	probably damaging	1.00
R0042:Obscn	UTSW	11	59052585	missense	probably damaging	1.00
R0064:Obscn	UTSW	11	59027466	missense	probably damaging	1.00
R0064:Obscn	UTSW	11	59027466	missense	probably damaging	1.00
R0071:Obscn	UTSW	11	59064201	missense	possibly damaging	0.85
R0077:Obscn	UTSW	11	59051521	splice site	probably benign
R0083:Obscn	UTSW	11	59022374	missense	probably damaging	1.00
R0089:Obscn	UTSW	11	59000062	missense	unknown
R0092:Obscn	UTSW	11	59051247	missense	possibly damaging	0.96
R0103:Obscn	UTSW	11	59062696	nonsense	probably null
R0103:Obscn	UTSW	11	59062696	nonsense	probably null
R0108:Obscn	UTSW	11	59022374	missense	probably damaging	1.00
R0152:Obscn	UTSW	11	59052576	missense	probably benign	0.06
R0268:Obscn	UTSW	11	59067272	missense	possibly damaging	0.78
R0271:Obscn	UTSW	11	59056742	intron	probably benign
R0281:Obscn	UTSW	11	59038615	missense	probably damaging	1.00
R0329:Obscn	UTSW	11	59040441	missense	probably damaging	1.00
R0329:Obscn	UTSW	11	59052506	missense	probably damaging	1.00
R0360:Obscn	UTSW	11	59128281	missense	probably benign	0.22
R0364:Obscn	UTSW	11	59128281	missense	probably benign	0.22
R0382:Obscn	UTSW	11	59040306	missense	probably damaging	1.00
R0386:Obscn	UTSW	11	59136339	missense	probably damaging	1.00
R0403:Obscn	UTSW	11	59076540	missense	probably damaging	1.00
R0413:Obscn	UTSW	11	59002997	missense	probably benign	0.03
R0437:Obscn	UTSW	11	58995088	unclassified	probably benign
R0442:Obscn	UTSW	11	59002174	splice site	probably benign
R0445:Obscn	UTSW	11	58999335	missense	unknown
R0446:Obscn	UTSW	11	58995412	unclassified	probably benign
R0454:Obscn	UTSW	11	58999623	missense	unknown
R0463:Obscn	UTSW	11	59061530	missense	probably benign	0.07
R0479:Obscn	UTSW	11	59112707	missense	probably damaging	1.00
R0480:Obscn	UTSW	11	59133946	nonsense	probably null
R0504:Obscn	UTSW	11	59008507	critical splice donor site	probably null
R0507:Obscn	UTSW	11	59029341	missense	probably damaging	1.00
R0513:Obscn	UTSW	11	59061522	missense	possibly damaging	0.81
R0541:Obscn	UTSW	11	59081984	missense	probably damaging	1.00
R0551:Obscn	UTSW	11	59107862	nonsense	probably null
R0573:Obscn	UTSW	11	59036079	missense	probably damaging	1.00
R0599:Obscn	UTSW	11	59073696	missense	probably damaging	1.00
R0637:Obscn	UTSW	11	59051644	missense	probably damaging	1.00
R0637:Obscn	UTSW	11	59082776	missense	probably damaging	0.96
R0653:Obscn	UTSW	11	59007708	unclassified	probably benign
R0712:Obscn	UTSW	11	59049445	missense	possibly damaging	0.72
R0715:Obscn	UTSW	11	59050480	missense	probably benign	0.23
R0729:Obscn	UTSW	11	59032709	missense	probably damaging	1.00
R0741:Obscn	UTSW	11	59063453	frame shift	probably null
R0745:Obscn	UTSW	11	59082239	missense	probably benign	0.14
R0751:Obscn	UTSW	11	59081819	missense	probably damaging	1.00
R0834:Obscn	UTSW	11	59133278	missense	probably benign	0.25
R0863:Obscn	UTSW	11	58995415	unclassified	probably benign
R0909:Obscn	UTSW	11	59075064	missense	probably damaging	1.00
R0965:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R0969:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R0980:Obscn	UTSW	11	58998061	missense	possibly damaging	0.92
R1017:Obscn	UTSW	11	58998353	missense	unknown
R1103:Obscn	UTSW	11	59021483	missense	probably damaging	1.00
R1107:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R1128:Obscn	UTSW	11	59028943	missense	probably null	0.71
R1164:Obscn	UTSW	11	59036087	missense	possibly damaging	0.65
R1192:Obscn	UTSW	11	59067199	missense	probably benign	0.33
R1298:Obscn	UTSW	11	59054897	missense	possibly damaging	0.65
R1331:Obscn	UTSW	11	59086928	missense	probably benign	0.09
R1333:Obscn	UTSW	11	59080317	missense	probably damaging	0.99
R1341:Obscn	UTSW	11	59029372	splice site	probably benign
R1385:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R1386:Obscn	UTSW	11	59133853	missense	probably damaging	1.00
R1390:Obscn	UTSW	11	59093448	missense	probably damaging	1.00
R1460:Obscn	UTSW	11	59055966	missense	probably damaging	1.00
R1495:Obscn	UTSW	11	59080160	missense	probably damaging	0.99
R1496:Obscn	UTSW	11	59031036	missense	probably benign	0.01
R1524:Obscn	UTSW	11	59115855	missense	probably damaging	1.00
R1526:Obscn	UTSW	11	59028586	missense	probably damaging	1.00
R1537:Obscn	UTSW	11	59000749	missense	unknown
R1554:Obscn	UTSW	11	59003648	missense	unknown
R1561:Obscn	UTSW	11	59036073	missense	probably damaging	1.00
R1589:Obscn	UTSW	11	59036075	missense	possibly damaging	0.89
R1615:Obscn	UTSW	11	59099825	missense	probably benign	0.09
R1627:Obscn	UTSW	11	59112638	missense	probably benign	0.14
R1634:Obscn	UTSW	11	59076896	missense	probably damaging	1.00
R1636:Obscn	UTSW	11	59122637	missense	probably damaging	1.00
R1681:Obscn	UTSW	11	59103325	missense	probably damaging	1.00
R1686:Obscn	UTSW	11	59106287	splice site	probably benign
R1713:Obscn	UTSW	11	59079886	missense	probably damaging	1.00
R1730:Obscn	UTSW	11	59073633	missense	probably damaging	1.00
R1781:Obscn	UTSW	11	59106337	missense	probably damaging	1.00
R1783:Obscn	UTSW	11	59073633	missense	probably damaging	1.00
R1793:Obscn	UTSW	11	59077780	missense	probably damaging	1.00
R1796:Obscn	UTSW	11	59029337	missense	possibly damaging	0.94
R1801:Obscn	UTSW	11	58998321	missense	unknown
R1824:Obscn	UTSW	11	58994832	unclassified	probably benign
R1856:Obscn	UTSW	11	59040296	missense	probably damaging	1.00
R1866:Obscn	UTSW	11	59060915	missense	probably benign	0.34
R1878:Obscn	UTSW	11	58995553	missense	probably damaging	0.99
R1883:Obscn	UTSW	11	59078203	missense	probably damaging	1.00
R1926:Obscn	UTSW	11	59063474	missense	possibly damaging	0.69
R1967:Obscn	UTSW	11	59135709	nonsense	probably null
R1975:Obscn	UTSW	11	59067729	missense	probably damaging	1.00
R1992:Obscn	UTSW	11	58995827	unclassified	probably benign
R2021:Obscn	UTSW	11	59067174	missense	probably benign	0.40
R2066:Obscn	UTSW	11	59135732	missense	possibly damaging	0.59
R2074:Obscn	UTSW	11	59069281	missense	probably damaging	0.99
R2074:Obscn	UTSW	11	59132652	missense	probably damaging	1.00
R2081:Obscn	UTSW	11	59034182	missense	possibly damaging	0.90
R2083:Obscn	UTSW	11	59073631	nonsense	probably null
R2086:Obscn	UTSW	11	59078256	missense	probably damaging	0.99
R2095:Obscn	UTSW	11	59093584	splice site	probably null
R2098:Obscn	UTSW	11	59069991	missense	probably damaging	1.00
R2114:Obscn	UTSW	11	59131658	missense	probably damaging	0.99
R2138:Obscn	UTSW	11	59003665	nonsense	probably null
R2193:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2194:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2210:Obscn	UTSW	11	59068087	missense	probably damaging	1.00
R2233:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2234:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2287:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2288:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2351:Obscn	UTSW	11	59112612	missense	probably damaging	0.99
R2376:Obscn	UTSW	11	59069124	missense	probably damaging	1.00
R2384:Obscn	UTSW	11	59042837	critical splice donor site	probably null
R2401:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2402:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2403:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2424:Obscn	UTSW	11	58994451	unclassified	probably benign
R2433:Obscn	UTSW	11	59039086	splice site	probably null
R2445:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2446:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2447:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2449:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2483:Obscn	UTSW	11	59080146	missense	probably damaging	1.00
R2484:Obscn	UTSW	11	59007540	unclassified	probably benign
R2496:Obscn	UTSW	11	59103442	missense	probably damaging	1.00
R2510:Obscn	UTSW	11	59042314	splice site	probably benign
R2851:Obscn	UTSW	11	59030018	critical splice donor site	probably null
R2878:Obscn	UTSW	11	59056188	missense	possibly damaging	0.94
R2879:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2885:Obscn	UTSW	11	59086748	missense	probably damaging	1.00
R2885:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2886:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R2985:Obscn	UTSW	11	59133089	missense	probably damaging	1.00
R3013:Obscn	UTSW	11	59060918	missense	probably damaging	1.00
R3118:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3236:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3237:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3432:Obscn	UTSW	11	59031177	missense	probably damaging	1.00
R3694:Obscn	UTSW	11	59078395	missense	probably damaging	1.00
R3716:Obscn	UTSW	11	59082661	missense	probably damaging	1.00
R3717:Obscn	UTSW	11	59082661	missense	probably damaging	1.00
R3743:Obscn	UTSW	11	59079085	missense	probably damaging	0.99
R3760:Obscn	UTSW	11	59028580	missense	probably damaging	1.00
R3795:Obscn	UTSW	11	59031841	missense	probably damaging	1.00
R3857:Obscn	UTSW	11	59080969	unclassified	probably benign
R3858:Obscn	UTSW	11	59080969	unclassified	probably benign
R3862:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3863:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3864:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3881:Obscn	UTSW	11	59056949	missense	probably damaging	1.00
R3890:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3903:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3923:Obscn	UTSW	11	59060928	missense	possibly damaging	0.96
R3944:Obscn	UTSW	11	59132547	missense	probably damaging	1.00
R3947:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3948:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R3955:Obscn	UTSW	11	59036768	missense	probably damaging	1.00
R3970:Obscn	UTSW	11	59051662	missense	probably damaging	1.00
R3971:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4001:Obscn	UTSW	11	59134569	missense	probably damaging	1.00
R4005:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4017:Obscn	UTSW	11	59132622	missense	probably damaging	1.00
R4028:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4029:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4041:Obscn	UTSW	11	59051531	nonsense	probably null
R4061:Obscn	UTSW	11	59008532	missense	probably damaging	1.00
R4062:Obscn	UTSW	11	59082710	missense	probably damaging	0.99
R4072:Obscn	UTSW	11	58997183	missense	unknown
R4078:Obscn	UTSW	11	59038363	missense	probably benign	0.41
R4079:Obscn	UTSW	11	59038363	missense	probably benign	0.41
R4092:Obscn	UTSW	11	59056060	missense	probably benign	0.12
R4106:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4108:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4403:Obscn	UTSW	11	59069093	missense	possibly damaging	0.95
R4477:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4478:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4480:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4489:Obscn	UTSW	11	59031591	missense	possibly damaging	0.74
R4531:Obscn	UTSW	11	59007874	unclassified	probably benign
R4551:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4552:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4553:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4558:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
R4570:Obscn	UTSW	11	59006828	splice site	probably null
R4575:Obscn	UTSW	11	59122772	missense	probably damaging	0.99
R4593:Obscn	UTSW	11	59133249	missense	probably damaging	1.00
R4604:Obscn	UTSW	11	59080205	missense	probably damaging	1.00
R4604:Obscn	UTSW	11	59122746	missense	probably damaging	0.96
R4625:Obscn	UTSW	11	59067258	missense	probably damaging	1.00
R4646:Obscn	UTSW	11	59124570	nonsense	probably null
R4651:Obscn	UTSW	11	59038877	missense	probably damaging	1.00
R4652:Obscn	UTSW	11	59038877	missense	probably damaging	1.00
R4657:Obscn	UTSW	11	59042290	missense	probably damaging	1.00
R4658:Obscn	UTSW	11	59054288	nonsense	probably null
R4662:Obscn	UTSW	11	58999596	missense	unknown
R4665:Obscn	UTSW	11	59124752	missense	probably damaging	1.00
R4718:Obscn	UTSW	11	59021954	missense	probably damaging	1.00
R4736:Obscn	UTSW	11	59063536	missense	probably damaging	1.00
R4746:Obscn	UTSW	11	59079808	critical splice donor site	probably null
R4754:Obscn	UTSW	11	59036043	missense	possibly damaging	0.81
R4758:Obscn	UTSW	11	59003363	missense	unknown
R4758:Obscn	UTSW	11	59135917	missense	probably damaging	0.98
R4766:Obscn	UTSW	11	59012742	missense	probably damaging	1.00
R4798:Obscn	UTSW	11	59069859	missense	probably damaging	0.99
R4810:Obscn	UTSW	11	59031591	missense	possibly damaging	0.74
R4819:Obscn	UTSW	11	59038848	missense	probably damaging	0.97
R4821:Obscn	UTSW	11	59006826	splice site	probably benign
R4822:Obscn	UTSW	11	59022333	missense	probably benign	0.11
R4828:Obscn	UTSW	11	59086670	missense	possibly damaging	0.93
R4829:Obscn	UTSW	11	59054246	missense	probably null	0.53
R4830:Obscn	UTSW	11	59067607	missense	probably damaging	1.00
R4859:Obscn	UTSW	11	59082023	missense	possibly damaging	0.89
R4870:Obscn	UTSW	11	59136206	missense	probably damaging	1.00
R4909:Obscn	UTSW	11	59061465	missense	possibly damaging	0.52
R4955:Obscn	UTSW	11	59069172	missense	probably benign	0.31
R4973:Obscn	UTSW	11	59132466	missense	probably damaging	1.00
R4993:Obscn	UTSW	11	59124761	missense	possibly damaging	0.48
R5034:Obscn	UTSW	11	59061676	nonsense	probably null
R5054:Obscn	UTSW	11	59073617	missense	probably damaging	1.00
R5077:Obscn	UTSW	11	59044057	missense	probably damaging	0.98
R5126:Obscn	UTSW	11	59077063	missense	probably damaging	1.00
R5135:Obscn	UTSW	11	59129653	missense	probably damaging	1.00
R5161:Obscn	UTSW	11	59028604	missense	probably damaging	1.00
R5161:Obscn	UTSW	11	59064310	missense	possibly damaging	0.60
R5195:Obscn	UTSW	11	59060850	missense	possibly damaging	0.78
R5222:Obscn	UTSW	11	59044145	missense	possibly damaging	0.80
R5260:Obscn	UTSW	11	59003369	missense	probably damaging	1.00
R5301:Obscn	UTSW	11	59135408	missense	probably damaging	1.00
R5305:Obscn	UTSW	11	59012715	missense	possibly damaging	0.83
R5323:Obscn	UTSW	11	58996877	missense	probably benign
R5333:Obscn	UTSW	11	59062692	missense	probably damaging	1.00
R5366:Obscn	UTSW	11	59080260	missense	probably damaging	1.00
R5368:Obscn	UTSW	11	59069026	critical splice donor site	probably null
R5408:Obscn	UTSW	11	59051611	missense	probably damaging	1.00
R5439:Obscn	UTSW	11	59000128	nonsense	probably null
R5536:Obscn	UTSW	11	59107871	missense	probably damaging	1.00
R5561:Obscn	UTSW	11	59036093	missense	probably damaging	0.99
R5573:Obscn	UTSW	11	59034705	missense	possibly damaging	0.94
R5582:Obscn	UTSW	11	59099976	splice site	probably null
R5586:Obscn	UTSW	11	59001468	nonsense	probably null
R5607:Obscn	UTSW	11	59122848	missense	probably benign	0.22
R5700:Obscn	UTSW	11	59133194	missense	probably benign	0.37
R5706:Obscn	UTSW	11	59076256	missense	probably damaging	1.00
R5718:Obscn	UTSW	11	59036808	missense	probably damaging	1.00
R5771:Obscn	UTSW	11	59000707	missense	unknown
R5772:Obscn	UTSW	11	59056144	missense	probably damaging	0.99
R5786:Obscn	UTSW	11	59032691	missense	probably damaging	1.00
R5807:Obscn	UTSW	11	59079650	missense	probably damaging	1.00
R5815:Obscn	UTSW	11	59082189	splice site	probably null
R5835:Obscn	UTSW	11	59002081	missense	probably benign	0.03
R5835:Obscn	UTSW	11	59042127	missense	probably damaging	1.00
R5846:Obscn	UTSW	11	59038609	missense	probably damaging	1.00
R5851:Obscn	UTSW	11	58994700	nonsense	probably null
R5933:Obscn	UTSW	11	58998505	missense	unknown
R5935:Obscn	UTSW	11	59006813	missense	unknown
R5974:Obscn	UTSW	11	59076547	missense	probably damaging	1.00
R5975:Obscn	UTSW	11	59122619	critical splice donor site	probably null
R6014:Obscn	UTSW	11	59038864	missense	probably damaging	1.00
R6026:Obscn	UTSW	11	59067090	missense	probably damaging	0.98
R6082:Obscn	UTSW	11	58999567	missense	unknown
R6124:Obscn	UTSW	11	59079044	missense	probably benign	0.45
R6130:Obscn	UTSW	11	59077945	missense	possibly damaging	0.90
R6160:Obscn	UTSW	11	59051785	missense	probably damaging	1.00
R6169:Obscn	UTSW	11	59000499	missense	unknown
R6177:Obscn	UTSW	11	59032664	missense	probably damaging	1.00
R6189:Obscn	UTSW	11	59069934	missense	probably benign	0.00
R6192:Obscn	UTSW	11	58998038	missense	unknown
R6195:Obscn	UTSW	11	58997207	missense	probably damaging	0.98
R6208:Obscn	UTSW	11	59067648	missense	possibly damaging	0.81
R6232:Obscn	UTSW	11	59052511	nonsense	probably null
R6233:Obscn	UTSW	11	58997207	missense	probably damaging	0.98
R6273:Obscn	UTSW	11	59076993	missense	possibly damaging	0.95
R6280:Obscn	UTSW	11	59063683	missense	possibly damaging	0.82
R6317:Obscn	UTSW	11	59069895	missense	probably damaging	1.00
R6345:Obscn	UTSW	11	59053696	missense	probably damaging	0.99
R6378:Obscn	UTSW	11	59073746	missense	probably damaging	1.00
R6382:Obscn	UTSW	11	58999413	missense	unknown
R6382:Obscn	UTSW	11	59042208	missense	probably damaging	0.99
R6415:Obscn	UTSW	11	59035130	missense	probably damaging	0.99
R6433:Obscn	UTSW	11	59051558	missense	probably benign	0.14
R6457:Obscn	UTSW	11	59080771	missense	probably damaging	0.99
R6508:Obscn	UTSW	11	59054147	splice site	probably null
R6611:Obscn	UTSW	11	59064230	splice site	probably null
R6614:Obscn	UTSW	11	59012801	missense	probably benign	0.01
R6645:Obscn	UTSW	11	59085262	missense	probably damaging	0.97
R6646:Obscn	UTSW	11	59082718	missense	possibly damaging	0.72
R6659:Obscn	UTSW	11	59039009	missense	probably damaging	1.00
R6723:Obscn	UTSW	11	59054998	missense	probably damaging	0.99
R6733:Obscn	UTSW	11	59028595	missense	probably damaging	0.99
R6755:Obscn	UTSW	11	59103326	missense	probably damaging	1.00
R6770:Obscn	UTSW	11	59044036	missense	possibly damaging	0.88
R6820:Obscn	UTSW	11	59051193	missense	probably damaging	1.00
R6823:Obscn	UTSW	11	59067943	critical splice donor site	probably null
R6850:Obscn	UTSW	11	59002129	missense	possibly damaging	0.92
R6850:Obscn	UTSW	11	59068124	missense	possibly damaging	0.93
R6862:Obscn	UTSW	11	58995453	unclassified	probably benign
R6884:Obscn	UTSW	11	59078302	missense	probably damaging	1.00
R6894:Obscn	UTSW	11	59132682	missense	probably benign	0.43
R6906:Obscn	UTSW	11	59032918	missense	possibly damaging	0.85
R6944:Obscn	UTSW	11	59038930	missense	probably damaging	1.00
R6948:Obscn	UTSW	11	59106316	missense	probably damaging	1.00
R6959:Obscn	UTSW	11	59037585	missense	probably damaging	1.00
R7000:Obscn	UTSW	11	59136038	missense	probably damaging	1.00
R7028:Obscn	UTSW	11	59079133	missense	probably damaging	1.00
R7037:Obscn	UTSW	11	59043929	missense	probably damaging	1.00
R7037:Obscn	UTSW	11	59052604	missense	probably damaging	0.98
R7056:Obscn	UTSW	11	58996296	unclassified	probably benign
R7112:Obscn	UTSW	11	59029325	missense
R7121:Obscn	UTSW	11	59013252	nonsense	probably null
R7123:Obscn	UTSW	11	59013651	missense	probably benign
R7182:Obscn	UTSW	11	59035101	missense	probably damaging	0.99
R7199:Obscn	UTSW	11	59012846	missense	probably benign	0.09
R7209:Obscn	UTSW	11	59085107	nonsense	probably null
R7235:Obscn	UTSW	11	59080840	missense	probably damaging	0.98
R7247:Obscn	UTSW	11	59103318	nonsense	probably null
R7262:Obscn	UTSW	11	59115889	missense	probably damaging	0.99
R7269:Obscn	UTSW	11	59043012	missense	probably damaging	0.99
R7270:Obscn	UTSW	11	59029486	missense
R7274:Obscn	UTSW	11	59133227	missense	probably damaging	1.00
R7312:Obscn	UTSW	11	59055616	missense	probably benign	0.00
R7313:Obscn	UTSW	11	59007588	missense	unknown
R7360:Obscn	UTSW	11	59082359	missense	probably damaging	1.00
R7380:Obscn	UTSW	11	59056914	missense
R7389:Obscn	UTSW	11	59036400	missense	probably benign	0.02
R7402:Obscn	UTSW	11	58995449	missense	unknown
R7417:Obscn	UTSW	11	59129577	missense	possibly damaging	0.93
R7432:Obscn	UTSW	11	59028907	missense
R7456:Obscn	UTSW	11	59008558	missense	probably benign	0.01
R7459:Obscn	UTSW	11	59131657	missense	probably benign	0.00
R7463:Obscn	UTSW	11	59122860	missense	probably benign	0.02
R7478:Obscn	UTSW	11	59093416	missense	probably damaging	1.00
R7498:Obscn	UTSW	11	59082713	missense	probably damaging	1.00
R7502:Obscn	UTSW	11	58994809	missense	unknown
R7509:Obscn	UTSW	11	59051629	missense	probably benign	0.36
R7516:Obscn	UTSW	11	59124590	nonsense	probably null
R7545:Obscn	UTSW	11	59038899	missense	probably damaging	1.00
R7549:Obscn	UTSW	11	59042838	critical splice donor site	probably null
R7582:Obscn	UTSW	11	59061427	nonsense	probably null
R7607:Obscn	UTSW	11	58998265	missense	unknown
R7609:Obscn	UTSW	11	59000299	missense	unknown
R7647:Obscn	UTSW	11	58997287	critical splice acceptor site	probably null
R7650:Obscn	UTSW	11	59060994	missense	probably benign	0.01
R7673:Obscn	UTSW	11	59027437	missense
R7743:Obscn	UTSW	11	59099777	missense	probably damaging	1.00
R7745:Obscn	UTSW	11	59060855	missense	probably damaging	1.00
R7823:Obscn	UTSW	11	59107940	missense	probably damaging	1.00
R7840:Obscn	UTSW	11	59077950	missense	possibly damaging	0.88
R7854:Obscn	UTSW	11	59090712	missense	probably benign	0.14
R7867:Obscn	UTSW	11	59000826	missense	unknown
R7874:Obscn	UTSW	11	59133276	missense	probably damaging	1.00
R7877:Obscn	UTSW	11	59133762	missense	probably damaging	1.00
R7883:Obscn	UTSW	11	59070009	nonsense	probably null
R7903:Obscn	UTSW	11	59079116	missense	probably benign	0.15
R7924:Obscn	UTSW	11	59112555	missense	probably benign	0.27
R7925:Obscn	UTSW	11	59112555	missense	probably benign	0.27
R7936:Obscn	UTSW	11	59050508	missense	possibly damaging	0.46
R7944:Obscn	UTSW	11	59093409	missense	probably damaging	1.00
R7945:Obscn	UTSW	11	59093409	missense	probably damaging	1.00
R7984:Obscn	UTSW	11	59106325	missense	possibly damaging	0.91
R8042:Obscn	UTSW	11	59040317	missense	possibly damaging	0.61
R8073:Obscn	UTSW	11	59135690	missense	probably benign	0.25
R8079:Obscn	UTSW	11	59081905	missense	possibly damaging	0.84
R8108:Obscn	UTSW	11	59061634	missense	probably benign	0.17
R8117:Obscn	UTSW	11	59042154	missense	possibly damaging	0.91
R8130:Obscn	UTSW	11	59124613	missense	probably damaging	1.00
R8135:Obscn	UTSW	11	59031877	missense	possibly damaging	0.60
R8175:Obscn	UTSW	11	58995960	missense	unknown
R8205:Obscn	UTSW	11	59007871	missense	unknown
R8211:Obscn	UTSW	11	59115794	missense	probably damaging	0.99
R8219:Obscn	UTSW	11	59122748	missense	probably benign	0.03
R8245:Obscn	UTSW	11	59022240	missense
R8290:Obscn	UTSW	11	59062710	missense	probably damaging	1.00
R8290:Obscn	UTSW	11	59124574	missense	probably damaging	0.99
R8300:Obscn	UTSW	11	59043070	missense	probably benign	0.02
R8346:Obscn	UTSW	11	59085181	missense	possibly damaging	0.80
R8384:Obscn	UTSW	11	59085109	missense	probably damaging	0.98
R8390:Obscn	UTSW	11	59002044	missense	probably benign	0.03
R8396:Obscn	UTSW	11	59003003	missense	probably benign	0.03
R8443:Obscn	UTSW	11	59038874	missense	probably damaging	0.99
R8469:Obscn	UTSW	11	59128237	missense	probably damaging	1.00
R8503:Obscn	UTSW	11	59000617	missense	unknown
X0010:Obscn	UTSW	11	58995553	unclassified	probably benign
X0012:Obscn	UTSW	11	59006776	missense	unknown
X0021:Obscn	UTSW	11	59077906	missense	probably damaging	0.96
X0058:Obscn	UTSW	11	59035968	missense	probably damaging	1.00
X0061:Obscn	UTSW	11	59077830	missense	probably damaging	1.00
X0063:Obscn	UTSW	11	59000056	missense	unknown
X0067:Obscn	UTSW	11	59131801	missense	probably benign	0.19
Y4336:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
Y4337:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
Y4338:Obscn	UTSW	11	59131646	missense	possibly damaging	0.90
Y5407:Obscn	UTSW	11	59021943	missense	probably damaging	0.97
Z1176:Obscn	UTSW	11	58994372	missense	unknown
Z1176:Obscn	UTSW	11	58995530	missense	unknown
Z1176:Obscn	UTSW	11	59038807	missense	probably damaging	1.00
Z1176:Obscn	UTSW	11	59040347	missense	probably benign	0.39
Z1176:Obscn	UTSW	11	59049725	missense	probably benign	0.01
Z1176:Obscn	UTSW	11	59082823	missense	probably benign	0.25
Z1176:Obscn	UTSW	11	59136286	missense	probably benign	0.39
Z1177:Obscn	UTSW	11	59000955	missense	probably benign	0.04
Z1177:Obscn	UTSW	11	59010444	missense
Z1177:Obscn	UTSW	11	59051543	missense	probably damaging	0.98
Z1177:Obscn	UTSW	11	59055490	missense	probably damaging	1.00
Z1177:Obscn	UTSW	11	59056039	missense	probably damaging	1.00
Z1177:Obscn	UTSW	11	59061015	missense	possibly damaging	0.68
Z1177:Obscn	UTSW	11	59062087	missense	probably damaging	1.00
Z1177:Obscn	UTSW	11	59062887	missense	probably damaging	1.00
Z1177:Obscn	UTSW	11	59135466	missense	possibly damaging	0.50

Predicted Primers

PCR Primer
(F):5'- TCATCGTCAGAGCTGGTGTG -3'
(R):5'- ACCTGGCGTATGATGGAGAAC -3'

Sequencing Primer
(F):5'- CAGAGCTGGTGTGTGAGAGGTC -3'
(R):5'- AGACGACCACAGCAGGGTC -3'

Posted On

2016-02-04