Incidental Mutation 'R4821:Cpd'
ID 370236
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Name carboxypeptidase D
Synonyms D830034L15Rik
MMRRC Submission 042437-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.922) question?
Stock # R4821 (G1)
Quality Score 179
Status Validated
Chromosome 11
Chromosomal Location 76669250-76737844 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76737063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 244 (I244V)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
AlphaFold O89001
Predicted Effect probably benign
Transcript: ENSMUST00000021201
AA Change: I244V

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: I244V

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Meta Mutation Damage Score 0.1246 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,092,871 (GRCm39) K150R probably damaging Het
Aak1 T C 6: 86,827,171 (GRCm39) V46A probably damaging Het
Abcb9 T C 5: 124,228,212 (GRCm39) T10A probably benign Het
Acaca A G 11: 84,185,813 (GRCm39) D116G possibly damaging Het
Adam33 G A 2: 130,903,115 (GRCm39) P43L probably benign Het
Adamtsl2 T A 2: 26,988,604 (GRCm39) probably null Het
Akap13 A G 7: 75,327,255 (GRCm39) probably benign Het
Art1 T A 7: 101,756,385 (GRCm39) L192Q probably damaging Het
Baalc A G 15: 38,796,575 (GRCm39) probably benign Het
Baz2a A G 10: 127,946,978 (GRCm39) E164G probably damaging Het
Bcs1l A G 1: 74,631,144 (GRCm39) I391V probably benign Het
Cacna1c T C 6: 118,673,386 (GRCm39) T497A probably damaging Het
Cap2 C A 13: 46,763,586 (GRCm39) T164N probably damaging Het
Ccdc57 A G 11: 120,751,225 (GRCm39) probably null Het
Ccdc88c T C 12: 100,904,338 (GRCm39) N1120S probably benign Het
Cfap210 T C 2: 69,612,452 (GRCm39) E96G possibly damaging Het
Chd7 T A 4: 8,844,706 (GRCm39) V1605D probably damaging Het
Col12a1 A T 9: 79,622,622 (GRCm39) probably benign Het
Commd3 T C 2: 18,677,339 (GRCm39) S22P probably benign Het
Cpeb2 C A 5: 43,390,817 (GRCm39) probably benign Het
Cyp2c65 A G 19: 39,060,635 (GRCm39) D165G probably damaging Het
Ddx1 T C 12: 13,289,148 (GRCm39) Y152C probably damaging Het
Dennd4a G A 9: 64,804,531 (GRCm39) C1290Y possibly damaging Het
Ebf4 G A 2: 130,148,965 (GRCm39) M232I probably benign Het
Farp2 A G 1: 93,502,192 (GRCm39) probably null Het
Frk T C 10: 34,360,233 (GRCm39) V78A probably benign Het
Gm5799 A G 14: 43,782,098 (GRCm39) D90G probably damaging Het
Gpr45 C G 1: 43,069,613 (GRCm39) probably benign Het
Hfm1 C T 5: 107,002,606 (GRCm39) probably null Het
Igkv4-57-1 T A 6: 69,521,387 (GRCm39) D105V probably damaging Het
Impdh2-ps A G 8: 100,757,995 (GRCm39) noncoding transcript Het
Kctd4 G A 14: 76,200,217 (GRCm39) V63I probably benign Het
Lcn6 T A 2: 25,570,822 (GRCm39) L137M probably damaging Het
Lonrf1 T C 8: 36,687,126 (GRCm39) N737D probably benign Het
Mcu C T 10: 59,303,511 (GRCm39) V109M probably damaging Het
Mecom C A 3: 30,039,500 (GRCm39) K186N probably damaging Het
Muc4 T C 16: 32,753,802 (GRCm38) I1226T probably benign Het
Mybpc1 T C 10: 88,384,727 (GRCm39) D533G probably damaging Het
Nae1 A C 8: 105,246,416 (GRCm39) C294G probably damaging Het
Ncapg2 T G 12: 116,379,077 (GRCm39) H190Q probably damaging Het
Nkx2-2 A T 2: 147,027,763 (GRCm39) L59Q possibly damaging Het
Nrxn3 C T 12: 90,171,483 (GRCm39) T295I probably damaging Het
Obscn C T 11: 58,897,652 (GRCm39) probably benign Het
Obscn A T 11: 58,931,293 (GRCm39) M5781K probably damaging Het
Or11g24 A G 14: 50,662,206 (GRCm39) T77A possibly damaging Het
Or4k39 T C 2: 111,239,570 (GRCm39) noncoding transcript Het
Or4z4 T A 19: 12,076,110 (GRCm39) M298L probably benign Het
Pcdhb6 C A 18: 37,467,381 (GRCm39) P101T probably damaging Het
Pot1b A G 17: 55,979,885 (GRCm39) S324P possibly damaging Het
Potefam1 T C 2: 111,034,490 (GRCm39) probably null Het
Ppcdc C T 9: 57,342,194 (GRCm39) V43I probably benign Het
Prr13 A T 15: 102,369,120 (GRCm39) probably benign Het
Rab10os T A 12: 3,287,322 (GRCm39) noncoding transcript Het
Rabgap1 T C 2: 37,422,531 (GRCm39) S595P probably damaging Het
Rap1gap T C 4: 137,439,440 (GRCm39) S126P probably damaging Het
Rgs6 A T 12: 83,114,185 (GRCm39) probably null Het
Slc5a6 T A 5: 31,194,228 (GRCm39) K610* probably null Het
Sun5 C T 2: 153,711,386 (GRCm39) V27I probably benign Het
Tmco5b T C 2: 113,120,102 (GRCm39) I126T probably benign Het
Tmed7 G A 18: 46,726,480 (GRCm39) Q92* probably null Het
Trav7d-2 A G 14: 52,921,885 (GRCm39) D98G probably benign Het
Trbv16 T A 6: 41,128,936 (GRCm39) L40Q probably damaging Het
Ush2a T C 1: 188,485,848 (GRCm39) V2986A probably benign Het
Usp33 T C 3: 152,064,310 (GRCm39) V58A probably benign Het
Vmn2r94 T A 17: 18,477,293 (GRCm39) M373L probably benign Het
Ywhaq T C 12: 21,467,512 (GRCm39) probably benign Het
Zbbx G A 3: 74,989,054 (GRCm39) H345Y possibly damaging Het
Zfp346 G T 13: 55,261,626 (GRCm39) probably benign Het
Zfp616 C T 11: 73,975,033 (GRCm39) A434V probably benign Het
Zfp992 C T 4: 146,551,976 (GRCm39) H566Y probably damaging Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76,688,615 (GRCm39) missense probably benign 0.00
IGL00698:Cpd APN 11 76,731,270 (GRCm39) missense possibly damaging 0.82
IGL01025:Cpd APN 11 76,686,439 (GRCm39) missense probably damaging 1.00
IGL01292:Cpd APN 11 76,737,071 (GRCm39) missense possibly damaging 0.80
IGL01571:Cpd APN 11 76,673,122 (GRCm39) missense probably damaging 1.00
IGL01606:Cpd APN 11 76,703,466 (GRCm39) missense probably benign
IGL02283:Cpd APN 11 76,731,251 (GRCm39) missense probably benign 0.19
IGL02895:Cpd APN 11 76,676,029 (GRCm39) missense probably benign 0.06
IGL02965:Cpd APN 11 76,681,814 (GRCm39) splice site probably benign
IGL03116:Cpd APN 11 76,702,539 (GRCm39) missense probably damaging 1.00
IGL03178:Cpd APN 11 76,696,877 (GRCm39) missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76,681,850 (GRCm39) missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76,688,614 (GRCm39) missense probably benign
R0050:Cpd UTSW 11 76,683,685 (GRCm39) missense possibly damaging 0.94
R0054:Cpd UTSW 11 76,681,664 (GRCm39) missense probably damaging 1.00
R0054:Cpd UTSW 11 76,681,664 (GRCm39) missense probably damaging 1.00
R0320:Cpd UTSW 11 76,731,273 (GRCm39) missense possibly damaging 0.50
R0416:Cpd UTSW 11 76,676,030 (GRCm39) missense probably benign 0.13
R0556:Cpd UTSW 11 76,693,171 (GRCm39) splice site probably benign
R0666:Cpd UTSW 11 76,673,153 (GRCm39) missense probably damaging 1.00
R0668:Cpd UTSW 11 76,675,224 (GRCm39) missense probably damaging 1.00
R1180:Cpd UTSW 11 76,692,579 (GRCm39) missense possibly damaging 0.56
R1472:Cpd UTSW 11 76,675,224 (GRCm39) missense probably damaging 0.98
R1518:Cpd UTSW 11 76,731,212 (GRCm39) critical splice donor site probably null
R1617:Cpd UTSW 11 76,737,495 (GRCm39) missense probably damaging 1.00
R1786:Cpd UTSW 11 76,683,624 (GRCm39) missense probably benign 0.00
R1854:Cpd UTSW 11 76,677,164 (GRCm39) missense probably damaging 1.00
R1861:Cpd UTSW 11 76,675,208 (GRCm39) splice site probably benign
R2159:Cpd UTSW 11 76,688,467 (GRCm39) missense probably damaging 0.96
R2205:Cpd UTSW 11 76,693,070 (GRCm39) missense probably damaging 0.99
R2281:Cpd UTSW 11 76,688,627 (GRCm39) missense probably benign 0.00
R2680:Cpd UTSW 11 76,681,825 (GRCm39) missense probably benign
R2928:Cpd UTSW 11 76,737,200 (GRCm39) missense probably benign
R2937:Cpd UTSW 11 76,702,685 (GRCm39) missense probably damaging 1.00
R4133:Cpd UTSW 11 76,705,644 (GRCm39) nonsense probably null
R4241:Cpd UTSW 11 76,737,611 (GRCm39) missense probably benign 0.03
R4369:Cpd UTSW 11 76,688,537 (GRCm39) missense possibly damaging 0.82
R4538:Cpd UTSW 11 76,681,825 (GRCm39) missense probably benign
R4551:Cpd UTSW 11 76,702,712 (GRCm39) missense probably damaging 1.00
R4617:Cpd UTSW 11 76,731,441 (GRCm39) missense probably damaging 1.00
R4732:Cpd UTSW 11 76,702,620 (GRCm39) missense probably damaging 0.99
R4733:Cpd UTSW 11 76,702,620 (GRCm39) missense probably damaging 0.99
R4852:Cpd UTSW 11 76,675,976 (GRCm39) missense probably benign 0.32
R4901:Cpd UTSW 11 76,681,707 (GRCm39) missense probably damaging 1.00
R4988:Cpd UTSW 11 76,705,656 (GRCm39) missense probably damaging 0.98
R4999:Cpd UTSW 11 76,737,048 (GRCm39) critical splice donor site probably null
R5005:Cpd UTSW 11 76,704,396 (GRCm39) missense probably damaging 1.00
R5092:Cpd UTSW 11 76,702,530 (GRCm39) missense possibly damaging 0.75
R5438:Cpd UTSW 11 76,682,792 (GRCm39) missense possibly damaging 0.65
R5524:Cpd UTSW 11 76,688,727 (GRCm39) nonsense probably null
R5677:Cpd UTSW 11 76,690,651 (GRCm39) missense probably benign
R5826:Cpd UTSW 11 76,675,242 (GRCm39) nonsense probably null
R6031:Cpd UTSW 11 76,681,714 (GRCm39) missense probably benign 0.00
R6031:Cpd UTSW 11 76,681,714 (GRCm39) missense probably benign 0.00
R6103:Cpd UTSW 11 76,690,625 (GRCm39) missense probably benign 0.00
R6257:Cpd UTSW 11 76,703,496 (GRCm39) missense probably benign 0.37
R6263:Cpd UTSW 11 76,737,097 (GRCm39) missense probably benign 0.00
R6485:Cpd UTSW 11 76,699,533 (GRCm39) splice site probably null
R6671:Cpd UTSW 11 76,686,359 (GRCm39) missense probably damaging 1.00
R6995:Cpd UTSW 11 76,675,881 (GRCm39) missense probably benign 0.02
R7074:Cpd UTSW 11 76,704,420 (GRCm39) missense probably damaging 1.00
R7192:Cpd UTSW 11 76,705,667 (GRCm39) missense probably damaging 1.00
R7341:Cpd UTSW 11 76,737,779 (GRCm39) missense unknown
R7371:Cpd UTSW 11 76,737,437 (GRCm39) missense probably benign 0.25
R7380:Cpd UTSW 11 76,693,151 (GRCm39) nonsense probably null
R7392:Cpd UTSW 11 76,692,605 (GRCm39) missense probably damaging 1.00
R7410:Cpd UTSW 11 76,673,134 (GRCm39) missense probably damaging 1.00
R7509:Cpd UTSW 11 76,688,702 (GRCm39) missense probably benign 0.17
R7767:Cpd UTSW 11 76,704,385 (GRCm39) missense probably benign 0.03
R8935:Cpd UTSW 11 76,731,295 (GRCm39) missense probably damaging 1.00
R9151:Cpd UTSW 11 76,675,275 (GRCm39) missense possibly damaging 0.54
R9172:Cpd UTSW 11 76,675,252 (GRCm39) missense probably benign 0.21
R9173:Cpd UTSW 11 76,699,649 (GRCm39) missense probably damaging 0.97
R9310:Cpd UTSW 11 76,705,607 (GRCm39) nonsense probably null
R9666:Cpd UTSW 11 76,693,133 (GRCm39) missense probably benign 0.02
Z1088:Cpd UTSW 11 76,692,572 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGCTTCTTTACAGTTAGC -3'
(R):5'- ACGTGTATTTGCTGCCCAG -3'

Sequencing Primer
(F):5'- CAGGCTTCTTTACAGTTAGCAAGAGG -3'
(R):5'- TGAACCCGGATGGCTTCGAAC -3'
Posted On 2016-02-04