Incidental Mutation 'R4821:Acaca'
ID370237
Institutional Source Beutler Lab
Gene Symbol Acaca
Ensembl Gene ENSMUSG00000020532
Gene Nameacetyl-Coenzyme A carboxylase alpha
SynonymsLOC327983, Acac, A530025K05Rik, acetyl-CoA carboxylase, Acc1
MMRRC Submission 042437-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4821 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location84129672-84401651 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84294987 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 116 (D116G)
Ref Sequence ENSEMBL: ENSMUSP00000139378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020843] [ENSMUST00000103201] [ENSMUST00000183887]
Predicted Effect probably benign
Transcript: ENSMUST00000020843
AA Change: D1295G

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020843
Gene: ENSMUSG00000020532
AA Change: D1295G

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 4.7e-33 PFAM
Pfam:CPSase_L_D2 272 472 2.5e-55 PFAM
Pfam:ATP-grasp 280 443 4.3e-7 PFAM
Pfam:ATP-grasp_4 282 442 1.9e-11 PFAM
Pfam:Dala_Dala_lig_C 284 440 5.4e-7 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 9.8e-19 PFAM
Pfam:ACC_central 818 1568 2.1e-288 PFAM
Pfam:Carboxyl_trans 1668 2222 1.6e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103201
AA Change: D1295G

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099490
Gene: ENSMUSG00000020532
AA Change: D1295G

DomainStartEndE-ValueType
Pfam:CPSase_L_chain 116 236 6.7e-29 PFAM
Pfam:ATP-grasp_4 239 442 2e-15 PFAM
Pfam:CPSase_L_D2 272 472 3.3e-55 PFAM
Pfam:Dala_Dala_lig_C 279 440 3e-7 PFAM
Pfam:ATP-grasp 281 442 1.1e-6 PFAM
Biotin_carb_C 506 613 3.76e-24 SMART
low complexity region 708 725 N/A INTRINSIC
Pfam:Biotin_lipoyl 751 817 3.7e-18 PFAM
Pfam:ACC_central 818 1568 3.5e-253 PFAM
Pfam:Carboxyl_trans 1668 2222 2.7e-175 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000183887
AA Change: D116G

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139378
Gene: ENSMUSG00000020532
AA Change: D116G

DomainStartEndE-ValueType
Pfam:ACC_central 1 228 8.6e-57 PFAM
Meta Mutation Damage Score 0.246 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.5%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. There are two ACC forms, alpha and beta, encoded by two different genes. ACC-alpha is highly enriched in lipogenic tissues. The enzyme is under long term control at the transcriptional and translational levels and under short term regulation by the phosphorylation/dephosphorylation of targeted serine residues and by allosteric transformation by citrate or palmitoyl-CoA. Multiple alternatively spliced transcript variants divergent in the 5' sequence and encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality before embryo turning with growth arrest at the egg cylinder stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921539E11Rik T C 4: 103,235,674 K150R probably damaging Het
4930430A15Rik T C 2: 111,204,145 probably null Het
Aak1 T C 6: 86,850,189 V46A probably damaging Het
Abcb9 T C 5: 124,090,149 T10A probably benign Het
Adam33 G A 2: 131,061,195 P43L probably benign Het
Adamtsl2 T A 2: 27,098,592 probably null Het
Akap13 A G 7: 75,677,507 probably benign Het
Art1 T A 7: 102,107,178 L192Q probably damaging Het
Baalc A G 15: 38,933,180 probably benign Het
Baz2a A G 10: 128,111,109 E164G probably damaging Het
Bcs1l A G 1: 74,591,985 I391V probably benign Het
Cacna1c T C 6: 118,696,425 T497A probably damaging Het
Cap2 C A 13: 46,610,110 T164N probably damaging Het
Ccdc173 T C 2: 69,782,108 E96G possibly damaging Het
Ccdc57 A G 11: 120,860,399 probably null Het
Ccdc88c T C 12: 100,938,079 N1120S probably benign Het
Chd7 T A 4: 8,844,706 V1605D probably damaging Het
Col12a1 A T 9: 79,715,340 probably benign Het
Commd3 T C 2: 18,672,528 S22P probably benign Het
Cpd T C 11: 76,846,237 I244V probably benign Het
Cpeb2 C A 5: 43,233,474 probably benign Het
Cyp2c65 A G 19: 39,072,191 D165G probably damaging Het
Ddx1 T C 12: 13,239,147 Y152C probably damaging Het
Dennd4a G A 9: 64,897,249 C1290Y possibly damaging Het
Ebf4 G A 2: 130,307,045 M232I probably benign Het
Farp2 A G 1: 93,574,470 probably null Het
Frk T C 10: 34,484,237 V78A probably benign Het
Gm5799 A G 14: 43,544,641 D90G probably damaging Het
Gpr45 C G 1: 43,030,453 probably benign Het
Hfm1 C T 5: 106,854,740 probably null Het
Igkv4-57-1 T A 6: 69,544,403 D105V probably damaging Het
Impdh2-ps A G 8: 100,031,363 noncoding transcript Het
Kctd4 G A 14: 75,962,777 V63I probably benign Het
Lcn6 T A 2: 25,680,810 L137M probably damaging Het
Lonrf1 T C 8: 36,219,972 N737D probably benign Het
Mcu C T 10: 59,467,689 V109M probably damaging Het
Mecom C A 3: 29,985,351 K186N probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Mybpc1 T C 10: 88,548,865 D533G probably damaging Het
Nae1 A C 8: 104,519,784 C294G probably damaging Het
Ncapg2 T G 12: 116,415,457 H190Q probably damaging Het
Nkx2-2 A T 2: 147,185,843 L59Q possibly damaging Het
Nrxn3 C T 12: 90,204,709 T295I probably damaging Het
Obscn C T 11: 59,006,826 probably benign Het
Obscn A T 11: 59,040,467 M5781K probably damaging Het
Olfr1285 T C 2: 111,409,225 noncoding transcript Het
Olfr1427 T A 19: 12,098,746 M298L probably benign Het
Olfr739 A G 14: 50,424,749 T77A possibly damaging Het
Pcdhb6 C A 18: 37,334,328 P101T probably damaging Het
Pot1b A G 17: 55,672,885 S324P possibly damaging Het
Ppcdc C T 9: 57,434,911 V43I probably benign Het
Prr13 A T 15: 102,460,685 probably benign Het
Rab10os T A 12: 3,237,322 noncoding transcript Het
Rabgap1 T C 2: 37,532,519 S595P probably damaging Het
Rap1gap T C 4: 137,712,129 S126P probably damaging Het
Rgs6 A T 12: 83,067,411 probably null Het
Slc5a6 T A 5: 31,036,884 K610* probably null Het
Sun5 C T 2: 153,869,466 V27I probably benign Het
Tmco5b T C 2: 113,289,757 I126T probably benign Het
Tmed7 G A 18: 46,593,413 Q92* probably null Het
Trav7d-2 A G 14: 52,684,428 D98G probably benign Het
Trbv16 T A 6: 41,152,002 L40Q probably damaging Het
Ush2a T C 1: 188,753,651 V2986A probably benign Het
Usp33 T C 3: 152,358,673 V58A probably benign Het
Vmn2r94 T A 17: 18,257,031 M373L probably benign Het
Ywhaq T C 12: 21,417,511 probably benign Het
Zbbx G A 3: 75,081,747 H345Y possibly damaging Het
Zfp346 G T 13: 55,113,813 probably benign Het
Zfp616 C T 11: 74,084,207 A434V probably benign Het
Zfp992 C T 4: 146,467,519 H566Y probably damaging Het
Other mutations in Acaca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Acaca APN 11 84278917 missense probably damaging 1.00
IGL01134:Acaca APN 11 84251279 missense probably benign 0.22
IGL01446:Acaca APN 11 84260631 missense probably damaging 1.00
IGL01591:Acaca APN 11 84243320 missense probably damaging 1.00
IGL01663:Acaca APN 11 84277802 missense possibly damaging 0.85
IGL01767:Acaca APN 11 84320542 missense probably benign 0.01
IGL02206:Acaca APN 11 84260747 nonsense probably null
IGL02335:Acaca APN 11 84214258 missense possibly damaging 0.84
IGL02477:Acaca APN 11 84307168 splice site probably benign
IGL02515:Acaca APN 11 84262403 missense probably benign
IGL02651:Acaca APN 11 84245204 splice site probably benign
IGL02805:Acaca APN 11 84223133 splice site probably benign
IGL03328:Acaca APN 11 84320529 missense probably benign 0.00
ANU05:Acaca UTSW 11 84315852 missense probably damaging 1.00
R0385:Acaca UTSW 11 84231748 missense probably benign 0.01
R0518:Acaca UTSW 11 84290286 critical splice acceptor site probably null
R0536:Acaca UTSW 11 84280516 splice site probably benign
R0962:Acaca UTSW 11 84311303 missense probably damaging 1.00
R0968:Acaca UTSW 11 84239033 nonsense probably null
R1123:Acaca UTSW 11 84264080 missense probably benign 0.09
R1452:Acaca UTSW 11 84295059 splice site probably benign
R1478:Acaca UTSW 11 84372627 missense probably damaging 1.00
R1500:Acaca UTSW 11 84293984 missense probably benign 0.00
R1512:Acaca UTSW 11 84195469 missense probably benign 0.00
R1657:Acaca UTSW 11 84264084 missense probably benign 0.09
R1681:Acaca UTSW 11 84226185 missense probably damaging 1.00
R1682:Acaca UTSW 11 84392217 missense probably benign 0.23
R1688:Acaca UTSW 11 84238896 missense probably damaging 1.00
R1755:Acaca UTSW 11 84276564 frame shift probably null
R1775:Acaca UTSW 11 84300422 missense possibly damaging 0.56
R1793:Acaca UTSW 11 84315969 missense probably damaging 0.98
R1793:Acaca UTSW 11 84338393 missense probably damaging 1.00
R1855:Acaca UTSW 11 84371554 missense probably damaging 0.96
R1881:Acaca UTSW 11 84270387 nonsense probably null
R1881:Acaca UTSW 11 84300471 splice site probably benign
R1989:Acaca UTSW 11 84262529 missense probably damaging 0.98
R2147:Acaca UTSW 11 84276536 missense probably benign 0.03
R2215:Acaca UTSW 11 84363793 missense probably damaging 1.00
R2238:Acaca UTSW 11 84391505 splice site probably benign
R2252:Acaca UTSW 11 84371532 missense probably damaging 0.99
R2316:Acaca UTSW 11 84264080 missense probably benign 0.16
R2316:Acaca UTSW 11 84294983 missense possibly damaging 0.69
R2337:Acaca UTSW 11 84257197 missense possibly damaging 0.93
R2697:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3551:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3552:Acaca UTSW 11 84261624 missense probably damaging 1.00
R3748:Acaca UTSW 11 84311409 unclassified probably null
R3844:Acaca UTSW 11 84364413 missense probably damaging 1.00
R3873:Acaca UTSW 11 84312721 unclassified probably benign
R4152:Acaca UTSW 11 84292926 missense possibly damaging 0.88
R4406:Acaca UTSW 11 84280449 missense probably benign 0.35
R4448:Acaca UTSW 11 84262492 missense probably damaging 1.00
R4642:Acaca UTSW 11 84280461 missense probably damaging 1.00
R4696:Acaca UTSW 11 84280435 missense possibly damaging 0.78
R4707:Acaca UTSW 11 84312854 missense probably damaging 0.96
R4710:Acaca UTSW 11 84392337 missense possibly damaging 0.84
R4775:Acaca UTSW 11 84243339 missense probably damaging 1.00
R4883:Acaca UTSW 11 84251290 missense probably benign 0.01
R4988:Acaca UTSW 11 84263295 missense probably damaging 1.00
R5034:Acaca UTSW 11 84245264 missense probably benign 0.00
R5255:Acaca UTSW 11 84311307 missense probably damaging 1.00
R5294:Acaca UTSW 11 84391519 missense probably benign 0.01
R5350:Acaca UTSW 11 84215873 missense probably damaging 0.99
R5437:Acaca UTSW 11 84346820 splice site probably null
R5664:Acaca UTSW 11 84243384 missense probably damaging 1.00
R5665:Acaca UTSW 11 84245294 nonsense probably null
R5959:Acaca UTSW 11 84215966 missense probably damaging 1.00
R6011:Acaca UTSW 11 84245744 missense probably benign 0.44
R6027:Acaca UTSW 11 84398177 missense probably benign
R6246:Acaca UTSW 11 84315970 missense probably benign 0.08
R6313:Acaca UTSW 11 84292929 missense probably benign 0.00
R6450:Acaca UTSW 11 84280468 missense probably damaging 0.98
R6623:Acaca UTSW 11 84371499 critical splice acceptor site probably null
R6736:Acaca UTSW 11 84238838 missense probably benign 0.05
R6752:Acaca UTSW 11 84195483 missense probably benign 0.44
R6807:Acaca UTSW 11 84391530 missense probably benign
R6826:Acaca UTSW 11 84195536 missense probably damaging 1.00
R7035:Acaca UTSW 11 84238943 missense probably damaging 1.00
R7078:Acaca UTSW 11 84263312 missense possibly damaging 0.91
R7088:Acaca UTSW 11 84278957 critical splice donor site probably null
R7201:Acaca UTSW 11 84262474 missense probably benign 0.41
R7261:Acaca UTSW 11 84368700 missense probably damaging 1.00
R7399:Acaca UTSW 11 84260679 missense possibly damaging 0.89
R7421:Acaca UTSW 11 84363736 missense possibly damaging 0.64
R7443:Acaca UTSW 11 84315793 missense probably benign 0.02
R7453:Acaca UTSW 11 84245310 missense probably benign
R7519:Acaca UTSW 11 84245856 missense probably damaging 0.98
R7537:Acaca UTSW 11 84260634 missense probably damaging 1.00
X0027:Acaca UTSW 11 84292895 missense probably benign 0.01
X0060:Acaca UTSW 11 84264104 missense probably benign
X0067:Acaca UTSW 11 84368737 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGACAGTTGGGCAGTAG -3'
(R):5'- GAAGGCAAAGCTAGCCATAGTC -3'

Sequencing Primer
(F):5'- AGTGTGCTTATTCCTACAGAGTAGC -3'
(R):5'- AAGCTAGCCATAGTCTTGAGAC -3'
Posted On2016-02-04